American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

A British pharmaceutical company, Henderson Morley plc have announced that they have been working on producing a vaccine against KHV (Koi Herpes Virus) over the past 10 months and from these initial studies are now ready to start field trials. According to the most recent virus taxonomy reported in 2012 by the International Committee on Taxonomy of Viruses (ICTV), DEV (also referred to as Anatid herpesvirus 1) is classified into the genus Mardivirus and the subfamily Alphaherpesvirinae of Herpesviridae[1]. In addition, we summarize the clinical and histopathological manifestations of the disease. Remember to have a suitable filtration system for the size of your pond, Koi can produce a large amount of waste which in turn will cause poor water quality and cause nothing but problems for your koi. Koi Herpesvirus (KHV) is a serious disease causing high mortalities and it creates consequences for Koi that survive it. In each strain, four to seven genes from among a set of nine are fragmented by frameshifts likely to render the encoded proteins nonfunctional. Twenty eight days post vaccination, the fish were challenged by injecting 10-4 ml/fish of KHV.

Frameshifts or other mutations close to the 3′ ends of coding sequences were identified in a further six genes. The conclusion that at least some of these mutations occurred in vivo prompts the hypothesis that loss of gene functions might be associated with emergence of the disease and provides a basis for further investigations into the molecular epidemiology of the virus. (2008) 82:4955-4964. The KHV-gD protein belongs to the transmembrane glycoprotein, with only a little part inside the cell, and the transmembrane spiral area of this protein is located at No.4-25of N end and No.341-363of C end, the part between which belongs to the envelope region. Culture of common carp provides a key source of protein for human consumption in Asia, Europe, and the Middle East (3, 35). As we concentrate on our Animal Health research programme, his vast experience will be of enormous benefit to the Company and its scientific advisory board”. www.fishupdate.com is published by Special Publications.

has produced and marketed KV-3, a live attenuated vaccine against koi herpes virus disease. The virus does not appear clinically when fish are held at cold water temperatures; however the fish does not mount an effective immune response at these cold temperatures to prevent further clinical appearance of the virus. Considerably more information has since been obtained on the properties of this virus, including its host range, the effects of water temperature on disease outcome, development of detection methods, and novel attempts at control (1, 4, 15-17, 20, 26, 27, 34, 37-39). The virus has now been found associated with mass mortality events on most continents, including countries throughout Europe, the United States, Japan, Indonesia, South Africa, Thailand, Taiwan, China, and Malaysia (22, 29, 42, 45). In the interim period white patches of dead tissue may appear on the gills and the skin. Bowser and J. Therefore no rights can be derived from this article.

As with any other disease, the quicker you act, the better the prognosis for the fish (the rest of the fish). Hedrick, unpublished data). Goldfish of any age may be infected with higher mortalities in juvenile fish. Several sequence deletions were observed in the microsatellite zone in KHV-K. A substantial number of viruses in the mammalian HV clade have been sequenced, but only three in the fish HV clade (ictalurid HV 1, IcHV-1, also known as channel catfish virus, and two ranid HVs [7, 10]) and one in the bivalve HV clade (ostreid HV 1, OsHV-1, also known as oyster HV [12]). It has been proposed that these clades should be classified as three families encompassed by an order, the Herpesvirales (8, 12). In phylogenetic trees (A-C), sequences from the USA (KHV-U), Israel (KHV-I), and Japan (KHV-J) CyHV-3 were clustered into one group, but amplified sequences from the Korean CyHV-3 (KHV-K) was highly distinguished from this group.

Early observations demonstrated the clear developmental and morphological affinities of KHV to the HVs (24), but subsequent findings prompted others to suggest that the virus should not be considered a member of the Herpesviridae (26, 38, 39). Key factors in this argument included the estimated genome size of KHV (277 kbp), which is greater than that observed previously among HVs (125 to 245 kbp), and the failure to demonstrate convincing genetic relationships between KHV and recognized HVs from limited sequence analyses. The encapsulated molecules will generally have completely different properties (e.g., solubility or circulating half-life) compared to the non-encapsulated ones. KHV is related closely to cyprinid HVs 1 and 2 (CyHV-1 and CyHV-2), the agents associated with carp pox and hematopoietic necrosis in goldfish, respectively (28, 41), and distantly to IcHV-1 and ranid HV 1 (RaHV-1, also known as Lucké tumor herpesvirus of frog) (46). Therefore, KHV has been proposed formally as a member of the Alloherpesviridae under the species name Cyprinid herpesvirus 3. On the other hand, vaccine-induced activation of APCs is limited in the absence of antigen replication for non-replicative vaccines. We confirm that KHV shares significant similarities to fish HVs and belongs as a new species in the family Herpesviridae.

The 295 kb genome of CyHV-3 codes for 156 open reading frames (Aoki et al., 2007) and the relative transcriptional timing for each gene has been annotated (Ilouze et al., 2012). Growth of viruses.KHV strain J was isolated from a dead koi on a farm in Japan. (b) Norris, A., Hutchison, M., Chilcott, K., and Stewart, D. Strain I was isolated in 1998 from adult koi during large mortalities in a producer plant on the coastal plain of Israel. It would be very stupid to risk every thing for one fish. Bulk virus preparations were made (passages 3, 12, and 30 for J, U, and I, respectively) and purified by sucrose gradient ultracentrifugation (16). Genome DNA was purified by phenol extraction and ethanol precipitation.

DNA sequencing.The complete genome sequences were determined commercially (Hitachi Instruments Service Co., Ltd., Tokyo, Japan) by standard shotgun sequencing. Butler, L-M. The KHV DNA inserts were sequenced from both ends of the plasmids by using the M13 forward and reverse primers with a BigDye Terminator v3.1 cycle sequencing kit and ABI 3700 and 3730xl DNA analyzers. DNA sequence analysis.The DNA sequences were assembled by using Phrap (14), employing the quality files and default settings to produce a consensus sequence that was edited by using Consed (18). The final consensus sequence in each case represented an average eightfold redundancy at each base position. Gap closure was achieved by primer walking of gap-spanning clones and sequencing of PCR products. The two ORF encoding the most abundant envelope proteins demonstrated interesting sequence homologies.

The genome termini in U were located precisely by PCR amplification of virion DNA that had been flush ended and ligated to a partially double-stranded adaptor oligonucleotide as described previously (13), using a primer matching part of the adaptor plus 5′-CGCAGTAGGCCTTGACCAGCA-3′ for the left terminus or 5′-AGGGTCTGAACATGGCTTAGG-3′ for the right terminus. The locations of the termini determined from sequencing of 12 plasmid clones of each product were assumed to be identical in J and I. The GCG suite (Accelrys) and other programs (19, 33) were used for standard analyses of the sequences. ATG-initiated open reading frames (ORFs) of >50 codons were evaluated initially for protein coding potential by using GAMBLER, which semiautomates analysis of the output from genome assembler software, assigns ORFs automatically, and carries out homology searching (40). Additional homology searches were carried out by using the FastA (36) and BLAST (2) tools, and alignments were made by using CLUSTAL W (44). The preliminary gene map was refined by using GCG Codonpreference, which measures codon preference and third position codon G+C bias on the basis of statistics generated from standard genes. Since KHV happens to be strongly biased in these measures, the analysis proved useful in revising the preliminary map, as a result of which most ORFs were confirmed as likely to be protein coding and several ambiguities were clarified.

Vaccines against virus infections, including infectious pancreatic necrosis, have also been used in commercial fish farming. Additional criteria routinely used in HV genome analysis were used, in particular the lack of extensive overlap between coding regions and the presence of polyadenylation signals downstream from ORFs or families of similarly oriented ORFs. Splicing is relatively rare in HVs, and predictions for KHV based on the presence of appropriately located splice donor and acceptor signals were kept to a minimum. The availability of an incomplete sequence database for the majority of the related CyHV-1 genome (T. Waltzek and R. Hedrick, unpublished data) enabled most predicted protein-coding regions in KHV (including splice sites) to be confirmed by homology and helped clarify many remaining difficulties. The vaccine may incite a more severe reaction if it is injected into the wrong portion of the fish.

Analysis of mutated regions.Regions containing frameshift mutations in one or another strain were amplified by standard PCR from U at passages 2 and 12 (the former from infected cell DNA and latter from infected cell DNA and purified virion DNA). In addition, data were obtained for a fourth KHV strain (CO5-53-3) at passage 0 (i.e., directly from infected fish tissue) and 2. The CO5-53-3 strain was obtained in 2005 from a moribund wild common carp during a mortality episode in the lower San Joacquin River, California. The core size was in the 96- to 105-nm range, with an average diameter of 103 nm. Genome characteristics.The size of the KHV genome as determined from the sequences is 295 kbp (295,271, 295,146, and 295,138 bp for J, U, and I, respectively). Restriction endonuclease digestion of the DNA preparations with NotI or XbaI yielded identical profiles for the three strains, with fragment sizes as predicted from the sequences (data not shown). The genome has a 22-kbp direct repeat at each terminus (22,437, 22,469, and 22,485 bp for J, U, and I, respectively).

The overall nucleotide composition for each is 59.2% G+C, and the frequency of the CG dinucleotide is as expected from this value. The genomes are highly similar to each other at the sequence level, with U and I more closely related to each other than either is to J. For example, in respect of single nucleotide substitutions (not counting duplicates in the terminal repeat), J differs from U and I at 181 of the 217 loci that are not conserved in all three strains; that is, there is a nucleotide difference every 1.5 kbp on average. Of the remaining 36 nonconserved loci, I differs from J and U at 32 loci, and U differs from J and I at 4 loci. These relationships imply a history in which an ancestral KHV strain gave rise initially to two branches: the J lineage that led eventually to J and the U/I lineage, which subsequently split into the branches leading to U and I. This conclusion is also consistent with the pattern of differences due to insertions and deletions. Genetic content.The close relationship among the three strains resulted in the same predicted gene map for each, with the exception of a number of fragmented ORFs discussed below.
American Society for MicrobiologyJournal of Virology

Figure 1 shows the predicted layout of protein-coding genes in an ancestral (wild-type) KHV as envisaged prior to gene fragmentation events. The genetic complement is 156, with 8 duplicated in the terminal repeat, yielding a total of 164 in the genome. Table 1 lists the features of KHV genes for which information was derived from bioinformatic analysis. Gene layout in wild-type KHV. The locations of predicted protein-coding ORFs (based on the strain J coordinates) are shown as defined in the key at the foot, with conserved genes (those with clear IcHV-1 homologs) differentiated from nonconserved genes, which include five gene families. We don’t know for sure where it hides when it’s not causing active disease. Nomenclature is given with the ORF prefix omitted, and the terminal repeat is shown in a thicker format than the rest of the genome.

Other symptoms are; excess of skin slime, loss of the slime coat, skin damage, loss of appetite, uncoordinated swimming and gasping for air. We view the gene layout as substantially accurate, but expect improvements to be made in the future. Alterations are most likely to come in the form of additional small ORFs, further splicing, and removal of present ORFs (e.g., perhaps ORF58 and ORF105, which we consider as the least likely ORFs to encode proteins). Mortality may be up to 100% in some outbreaks. Indeed, despite a substantially greater genome size, KHV is predicted to have fewer genes than the largest human HV, human cytomegalovirus (165 genes in a genome of 236 kbp, or 0.70 per kbp; 13). The KHV genome contains 15 genes (colored red in Fig. 1) that have clear homologs in IcHV-1.

The data for IcHV-1 and other HVs (7-9) indicate that these genes encode proteins involved in capsid morphogenesis (ORF92, ORF72, and ORF78, encoding two structural components of the capsid shell and a candidate protease involved in capsid maturation), nucleotide metabolism (ORF19 and ORF123 encoding deoxynucleoside kinase and deoxyuridine triphosphatase, respectively), DNA replication (ORF79, ORF71, and ORF46, encoding DNA polymerase, helicase, and a candidate primase), and DNA packaging (ORF33, which encodes the putative ATPase subunit of terminase; the three exons that comprise this coding region are shown in Fig. 1 as connected by introns). In addition, the conserved genes include one encoding a large membrane glycoprotein (ORF99) and five encoding proteins with unknown functions (ORF47, ORF61, ORF80, ORF90, and ORF56). During the production process with all these methods impurities are formed, thus requiring an additional purification step [63]. When the ranid HV sequences (10) are taken into account, only 13 genes are convincingly conserved: the 15 genes conserved between KHV and IcHV-1 as described above, less ORF19 and ORF123. These findings indicate that the fish HV clade is considerably more divergent overall than the mammalian HV clade, in which 43 genes have been inherited from a common ancestor (8). Thus, it is difficult to determine the threshold level of IgT able to deter pathogen attachment, colonization, and entry at mucosal surfaces.

It is likely that the number of conserved genes in the fish HV clade will increase as data for other species facilitate more sensitive comparisons, but not to the number observed in the mammalian HV clade. As is the case with distantly related viruses in the mammalian HV clade (8), conserved genes are located centrally in the KHV and IcHV-1 genomes, and their arrangement is not conserved. The remaining 141 KHV genes are in the nonconserved set. These are colored pink in Fig. 1, except for five families of related genes. The RING family encodes four proteins containing a zinc ion-coordinating motif known as the RING finger. This motif is ubiquitous among the HVs and is encoded by representatives of the three clades.

The tumor necrosis factor receptor (TNFR) family encodes two versions of a secreted form of TNFR, which presumably have roles in immune evasion, as demonstrated with the poxviruses (43). The ORF2 and ORF22 families encode two and three proteins, respectively. Haq, K., K.A. The putative products of several KHV genes are convincingly related to enzymes in addition to those described above. These include the large and small subunits of ribonucleotide reductase (ORF141 and ORF23, respectively), thymidine kinase (ORF55), thymidylate kinase (ORF140), uracil-DNA glycosylase (ORF98), serine protease (ORF94), and serine-threonine protein kinase (ORF104). KHV also encodes proteins related to G protein-coupled receptors (ORF16), eukaryotic DUF614 proteins (ORF31), a family of iridovirus proteins (ORF32), nucleoside transporters (ORF64), a cellular protein of unknown function (ORF114), and a poxvirus B22R protein (ORF139) that is likely to be involved in immune evasion (30). Like some members of the mammalian HV clade (6), KHV encodes a protein that is clearly related to interleukin-10 (ORF134), which may modulate host immune responses.

sequences available. It is apparent from the conserved and nonconserved gene sets that KHV evolution has been characterized by gene capture from the cell or other viruses. Strain evolution.As mentioned above, the three KHV strains differ from each other at only a small number of loci. A few of the insertions and deletions represent mutations (usually frameshifts) in one or more strains that disrupt coding regions. It should be noted that the identification of affected ORFs depends upon the accuracy of the predicted gene set and, moreover, that genes mutated in all strains may only be identified in certain circumstances. This is possible when such genes are members of a family or are related to genes in other organisms or where the encoded proteins contain characteristic features, such as those of a membrane protein with a signal sequence and transmembrane region. Despite these analytical limitations, 15 ORFs (10% of the complement) appear to be mutated in one or more strains (Table 1).

Of these, the unmutated forms of 11 ORFs encode proteins with features implying that their assignment as protein-coding regions at least is correct. It is notable that the majority of mutated ORFs encode membrane glycoproteins and that none of the conserved genes is affected. Nine genes (listed as “broken” in Table 1) are probably rendered nonfunctional by frameshifts located centrally in the coding regions, and the wild-type gene is identified readily. Six genes (listed as “frameshifted”) might retain function since the mutations are close (sometimes very close) to the 3′ ends of the ORFs, making it more difficult to identify the wild-type gene (see the assumptions explained in the footnotes to Tables 1 and 2). Nonetheless, even though identification of the precise number of mutated genes in each genome is problematic, all three sequenced strains are evidently multiple mutants derived from a wild-type ancestor. Since the sequenced DNAs were obtained from KHV strains passaged in cell culture, it is possible that some of the mutations occurred after isolation from infected fish. Unfortunately, the tissues from which the strains had been isolated were no longer available, and it was not possible to examine the unpassaged viruses.

This process may take several months or longer, depending upon the situation. The distribution of mutations in a subset of the loci in Table 1 is summarized in Table 2. The combined data indicate that mutations in three genes arose in vivo, since they are present in more than one of the sequenced viruses: that in ORF30 in U and I and those in ORF26 and ORF40 in J, U, and I. Mutations in six genes (ORF16, ORF55, ORF87, ORF94, ORF108, and ORF116) are present in a single strain each and therefore may have arisen in vivo or in vitro. The skin showed a lack of luster, with pale patches and increased mucus secretions (22, 23, 34, 35; Bergmann, unpublished data). We conclude that mutations occurred in vivo in ORF26 and ORF40 prior to divergence of the three strains from a wild-type parent, with a mutation then arising in vivo in ORF30 after the U/I lineage had diverged from the J lineage. In the absence of the original infected tissues, it was not possible to determine whether subsequent mutations occurred in vivo or in vitro.

The sequence comparisons indicate that the three sequenced KHV strains arose via the loss of genetic functions, as evidenced by frameshifted coding regions, with at least some of the cognate mutations having occurred in vivo. Elsewhere among large DNA viruses, fragmented genes have been documented extensively in the Poxviridae, particularly the Orthopoxvirus genus, where up to 16% of genes in a single virus may be fragmented (21). These genes are invariably not required for virus growth in cell culture and are therefore presumed to contribute to some aspect of growth in the host. The simplest interpretation is that some orthopoxviruses have become associated with their hosts relatively recently and have diverged from an ancestral virus by losing certain functions either because these functions are not required or because they reduce fitness. Gene fragmentation was also observed in the bivalve HV, OsHV-1, which had not been passaged in cell culture, suggesting that this might have contributed to the striking pathogenicity (and perhaps increased host range) of this emerging virus in farmed shellfish (12). The apparent loss of KHV gene functions, particular among those encoding membrane glycoproteins that may be associated with host specificity and critical to virulence, presents a provocative parallel. Nonetheless, a role for gene loss in the emergence of KHV is currently speculative.

Origins of KHV.The epidemiologic and pathogenic features of KHV-associated disease are new, and we doubt that they were overlooked previously (23, 46). The earliest known archival evidence indicates the presence of KHV among wild common carp in the United Kingdom as early as 1996 (K. Way, unpublished data), preceding observations of the disease in koi in Germany that were first recorded in 1997 (5). The active and often unregulated movements of large numbers of koi have contributed to a rapid spread of the virus presumably from these origins (22). The first cases of the disease in the eastern United States (strain U) occurred in 1998 following a koi show in New York that involved fish from Israel (24), a finding consistent with the high degree of similarity between U and I. Causal links for the origin of KHV among common carp in Japan are less defined (42). Despite these observations, the origins of KHV remain obscure.

It is possible that it has derived from an innocuous virus of C. In the research center marked carps are bred in a sterile environment so it is a 100% certainty that they do not carry any virus. In this respect, findings with KHV have relevance beyond carp aquaculture, since similar phenomena have been observed with herpesviruses of other intensively cultured animals, including Marek’s disease virus in chickens, where the evolution of increasingly virulent strains is exacerbated by vaccination (32), and perhaps OsHV-1 in oysters (12). The sequence comparisons prompt the hypothesis that intensive culture of common carp and koi, combined with large-scale movements of live koi, may have favored transmission of genetically deficient KHV strains of enhanced virulence. Testing of this hypothesis will include further extensive comparisons of KHV isolates that have not been passaged in cell culture in order to understand the extent and timescale of gene loss and specific mutagenesis studies in order to assess any contribution of gene loss to pathogenicity. Whether or not further adaptation might occur, more active control measures, including listing of the KHV disease by international organizations charged with disease control, are probably needed to reduce future economic and ecologic impacts of this important viral pathogen. This research was supported in part by the Tokyo University of Marine Science and Technology, by the United Kingdom Medical Research Council, and by a grant from the Center for Study of Emerging Diseases (Israel) and BARD (United States-Israel Binational Agricultural Research and Development Fund project no.

IS-3539-04CR).

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

2.2. There is a short period of lytic gene expression in the early stage of KSHV primary infection. In HH-B2, a newly established primary effusion lymphoma (PEL) cell line, KSHV ORF50 behaved as an immediate-early gene and autostimulated its own expression. The Rta transcriptional activator, which acts as a molecular switch for lytic reactivation of KSHV, was efficiently integrated downstream of the Flp recombination target site, and its expression was tightly controlled by tetracycline. This typically involves expression of a large number of genes and high copy numbers of the viral genome, but again can be highly restricted to a small number of cells in a specific location. These results demonstrate that the recruitment of CBP, SWI/SNF, and TRAP/Mediator complexes by RTA is the principal mechanism to direct well-controlled viral gene expression and thereby viral lytic reactivation. In cells infected with a Us11 mutant, elevated levels of activated PKR and phosphorylated eIF2alpha were detected, viral translation rates were reduced 6- to 7-fold, and viral replication was reduced 13-fold compared to replication in cells infected with either wild-type virus or a virus in which the Us11 mutation was repaired.
American Society for MicrobiologyJournal of Virology

The first takes place without the need for phosphorylation and before or during nuclear egress of capsids, whereas the second occurs in the Golgi apparatus and requires phosphorylation of VP8. These results indicate that HHV-6B gH can complement the function of HHV-6A gH in the viral infectious cycle. During latency, KSHV-infected cells can experience secondary infection with other viruses, including HCMV, HSV1 and HHV6, which will induce the innate immune response and KSHV reactivation 10, 11, 12. HHV-6 isolates can be categorized into HHV-6 variant A (HHV-6A) and HHV-6B based on their genetic, antigenic, and cell tropism properties (6, 8, 24, 33). Like other herpesviruses, KSHV exhibits two distinct life cycle phases after infection: lytic and latent replication. The maturation and egress of WT and mutant BoHV-1 was studied showing a process similar to that reported for other alphaherpesviruses. Together, these findings suggest that MAPK pathways might have general roles in regulating the life cycle of KSHV by mediating both viral infection and switch from viral latency to lytic replication.

Furthermore, mutant VP8 remained nuclear throughout infection in contrast to WT VP8, which is nuclear at early stages and Golgi-associated late during infection. Inhibitors of SIRTs can reactivate KSHV from latency. While environmental toxins and endogenous metabolites are potential physiological sources of DNA damage that trigger FA pathway activation (Langevin et al., 2011; Rosado et al., 2011), the capacity of natural processes like infection to activate and possibly subvert FA pathway function remains relatively unexplored. Therefore, host miRNAs display a spectrum of gene regulatory activities with phenotypic consequences ranging from subtle to profound, and it may be expected that virus-encoded miRNAs will behave the same.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

The herpes simplex virus type 1 (HSV-1) UL25 gene encodes a minor capsid protein, pUL25, that is essential for packaging the full-length viral genome. Cell-intrinsic defenses counteract uncoating through the binding of defensins. HD5 is broadly antimicrobial, exhibiting potent antiviral activity against HPV at physiologic concentrations; however, the specific mechanism of HD5-mediated inhibition against HPV is unknown. Isolated capsids prepared from virus were incubated with cytosol and purified nuclei. They were found to bind to the nuclear pores. We found a threshold for efficient retrograde transport in axons between MOIs of 1 and 10 and a threshold for productive infection in the neuronal cell bodies between MOIs of 1 and 0.1. Purified virions used for analysis were characterized by mass spectrometry to provide a positive identification of tegument proteins present and by quantitative SDS-polyacrylamide gel electrophoresis to measure protein copy numbers.

American Society for MicrobiologyJournal of Virology
M. Keil, and T. The capsid protein assembles into hexameric rings that oligomerize to form the distinctive conical shell, which is delivered into the cytoplasm after membrane fusion. Animals used for the present study were anesthetized with 10 mg/kg of ketamine for collection of 10 ml of blood used for this study. Total body clearance of interferon-alpha is nearly twice the glomerular filtration rate, suggesting active tubular secretion, renal catabolism, or extrarenal elimination. 80:6235-6246, 2006). In contrast, HSV-1 pUL25 has been assigned a role in stable packaging of viral genomes (N.

In humans, echovirus infections are associated with meningitis, encephalitis, rash, respiratory infections, diarrhea, and even fatal illness in newborns (4). Virol. The classical type of NLSs is represented by a mono- or bipartite stretch of basic amino acids (particularly lysine) [15]. Induced pluripotent hepatic stem cells from pigtail macaques are capable of supporting the entire replication cycle of HCV; however, infection inefficiencies were identified at the point of viral entry, specifically due to an ineffective form of CD81. The nuclear pore complex (NPC) serves as both gate and gatekeeper to the nucleus. Gorgacz and V. Neuronal trafficking during entry and egress.

The first description of culturing dissociated neurons in compartmented chambers was published in 1977 by R. Whereas a HSV-1 pUL25-expressing cell line partially complemented the pUL25 defect in PrV, reciprocal complementation of a HSV-1 UL25 deletion mutant by PrV pUL25 was not observed. There are approximately 20 subtypes of IFN-alpha but only one IFN-beta and IFN-gamma.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Herpes simplex virus (HSV) DNA polymerase (Pol) mutations can confer resistance to all currently available antiherpetic drugs. Although many vaccine candidates have shown promising results in animal models, they have failed to be effective in human trials. The vhs1 point mutation (Thr 214→Ile) eliminates vhs function during virus infection and in transiently transfected mammalian cells and was therefore previously considered to abolish vhs activity. Here, VP24 was shown for the first time to dampen interferon stimulatory DNA (ISD) triggered IFN-β production and inhibit IFN-β promoter activation induced by cyclic GMP-AMP synthase (cGAS) and stimulator of interferon genes (STING) or STING respectively. It is generally never referred to as Herpes, although that’s what it is. Interestingly, about 40% of the E+P-treated mice were also protected. Upon examination of viral shedding in the vaginal secretions, it was clear that protection against challenge was dependent on the ability of the TK− virus to cause productive genital infection under different hormonal conditions.
American Society for MicrobiologyJournal of Virology

Moreover, VP8 did not reduce STAT1 tyrosine phosphorylation to down-regulate IFN-β signaling. This has led to highly significant suppression of HCMV in the phase II trial, when the drug was given prophylactically. Dellaire came up with a fluorescent tagging technique that allows scientists to identify when gene targeting has been successful in a cell — even in those that don’t divide. Since STDs and STIs are so common, physicians are rarely surprised by a positive diagnosis. High titers of gB-specific local immunoglobulin A (IgA) antibodies were present in the vaginal secretions of S- and P4-treated immunized mice following HSV-2 challenge. Data from the years 2000 to 2011 are used when discussing changes over time. These studies show that sex hormones modify the induction of protective immune responses following IVAG immunization.

↵*Corresponding author. Careful when that my desk just stunned if people not. West, Hamilton, Ontario, Canada L8N 3Z5. He shal free website hosting and web page building – mount pleasant estate planning web hosting package american based front page compatible could someone like hitler ever gain power again 1 hosting page web server state quarters collectors book free front page extenstions web hosting? 22988. Fax: (905) 522-6750. Curable with antibiotics.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

To cite this article: Tae Woo Kim, Chien-Fu Hung, Jeong Won Kim, Jeremy Juang, Pei-Jer Chen, Liangmei He, David A.K. The immune response to the vaccine in these patients was compared to the immunological status of 20 non-vaccinated control patients with recurrent HSV infection. Many illnesses occur because of gene defects that prevent our bodies from making critical proteins. Virol. More than three decades ago, Wolff showed that the injection of mouse muscle with a DNA plasmid resulted in significant expression of the protein encoded by the plasmid[21]. Intravulvomucosal DNA immunization induced strong cellular immune responses and primed humoral immune responses. Most are investigating treatments for HIV and cancer, while others involve influenza, hepatitis B and C, HPV, and malaria.

The results strongly suggest that intravenous immunization of naked pDNA may induce humoral and cellular immune responses against the virus, leading to a significant prophylactic outcome against HSV-1 infection in mice. Human trials are underway testing the safety and efficacy of DNA vaccines against influenza, malaria, hepatitis B virus, HIV, herpes simplex virus, colon cancer and cutaneous T cell lymphoma. In this section, we wish to make two broad points: (i) the host mounts the type of immune response best suited to eradicating the particular type of microbe which it faces; and (ii) the type of immune response mounted is dictated by the interaction of the infectious agent with the host’s antigen presentation pathways. The direct in vivo transfer of genes can be accomplished in various tissues by different means. The initiation of immune or inflammatory reactions is a complex process involving the coordinated expression of costimulatory molecules, adhesion molecules, cytokines, and chemokines. In particular, chemokines are important in the molecular regulation of trafficking of immune cells to the peripheral sites of host defenses. Similarly, replication-defective mutant adenoviruses [7], poxviruses [8], and alphaviruses [9] have been studied as vaccine vectors.

These chemokines have been shown to induce direct migration of various immune cell types, including neutrophils, eosinophils, basophils, and monocytes (1, 2, 30, 36, 47). A 1992 landmark Science report was among the first to employ the heterologous prime-boost immunization technique in a non-human primate model [4]. Its genome contains approximately 8,000 base pairs, which encodes two classes of proteins: early and late proteins (for review, see [5]). Obtain acyclovir for intravenous injection from a clinical pharmacy at 50 mg/ml, and hold concentrated drug at room temperature. Recent studies support the notions that chemokine receptors mark T-cell subsets and that chemokines may be involved in the generation of antigen-specific immune responses (14, 35). In this study, we reasoned that we could utilize the DNA vaccine model to investigate whether chemokines could modulate immune responses and then impact protection from herpes simplex virus type 2 (HSV-2) challenge in a defined mouse model system. To investigate the modulation of immune responses and protective immunity, we codelivered a DNA expression construct encoding HSV-2 gD protein with plasmids encoding selected chemokines, specific-receptor-responsive chemokines (IL-8 and IP-10) and shared-receptor-responsive chemokines (RANTES, MCP-1, and MIP-1α).

We then analyzed their modulatory effects on antigen-specific immune induction and protection from challenge. We observed that coinjection with IL-8 and RANTES enhanced antigen-specific Th1 type CD4+T-cell immune responses and protection from HSV challenge. On the other hand, coinjection with IP-10, MCP-1, and MIP-1α had overall detrimental effects on protection status. These studies support the idea that chemokines can modulate important immune responses and disease progression in a manner reminiscent of cytokines. Significant immune modulation could be achieved through the use of codelivered chemokine cDNAs, impacting not just an immune response but also protection from disease. Furthermore, use of chemokine gene-delivered adjuvants, in particular IL-8 and RANTES, could be important in crafting more efficacious vaccines as immune therapies or contributors to immune therapies for HSV. Mice.Female 4- to 6-week-old BALB/c mice were purchased from Harlan Sprague-Dawley (Indianapolis, Ind.).
American Society for MicrobiologyJournal of Virology

They were cared for according to the guidelines of the National Institutes of Health (Bethesda, Md.) and the University of Pennsylvania IACUC (Philadelphia). Titers were measured in Vero cells and expressed as PFU per milliliter. Schaffer, University of Pennsylvania, Philadelphia) was propagated in the Vero cell line. The mice were raised at the Experimental Animal Center, Medical College, Southeast University, Nanjing, China, under pathogen-free conditions in air filtered containers. The expression vectors pCDNA3-IL-8, pCDNA3-IP-10, pCDNA3-RANTES, pCDNA3-MCP-1, and pCDNA3-MIP-1α were previously constructed in our laboratory (14). Plasmid DNA was produced in bacteria and purified by double-banded CsCl preparations. Recombinant HSV-2 gD proteins, a generous gift from G.

J Gene Med 2010; 12:818 – 31; http://dx.doi.org/10.1002/jgm.1499; PMID: 20806425 [CrossRef], [PubMed], [Web of Science ®] View all references High plasmid yields achieved at the 10 L process development scale were maintained at the 320 L cGMP scale ( and Fig. Cohen and R. J. Eisenberg, University of Pennsylvania, were used as recombinant antigens in these studies. DNA inoculation of mice.The quadriceps muscles of BALB/c mice were injected with gD DNA constructs formulated in 100 μl of phosphate-buffered saline and 0.25% bupivacaine-HCl (Sigma, St. Louis, Mo.) via a 28-gauge needle (Becton Dickinson, Franklin Lakes, N.J.). Samples of various chemokine and cytokine gene expression cassettes were mixed with pgD plasmid solution prior to injection.

ELISA.An enzyme-linked immunosorbent assay (ELISA) was performed as previously described (40, 43). In particular, for the determination of relative levels of gD-specific immunoglobulin G (IgG) subclasses, anti-murine IgG1 and IgG2a conjugated with horseradish peroxidase (HRP) (Zymed, San Francisco, Calif.) were substituted for anti-murine IgG-HRP. To determine ELISA titers, pools comprising equal numbers of serum samples for each group were twofold serially diluted from 1:100 and reacted with gD protein. Tumor growth was otherwise followed for a period of 60 days after the challenge. In vitro depletion of CD4+ and CD8+ T cells.Splenocytes were reacted with anti-CD4 or anti-CD8 antibodies for 1 h at 4°C, followed by incubation with rabbit complements for 1 h at 37°C. Cell viability postdepletion was determined by trypan blue dye exclusion. Two cycles of antibodies plus complements resulted in depletion of more than 98% of each specific T-cell subpopulation as determined by fluorescence-activated cell sorter (FACS) analysis.

In vivo depletion of CD4+ T cells.One hundred microliters of anti-CD4 (clone GK1.5) ascites fluid (a kind gift from N. Chirmule of the University of Pennsylvania) was administered intraperitoneally (i.p.) as previously described (41). Antibody treatment resulted in more than 98% depletion of specific CD4+ T-cell subsets of representative animals over a 3-week period. Depleted mice were subsequently challenged with virus on day 0. Th1 and Th2 type cytokines and chemokines.A 1-ml aliquot containing 6 × 106 splenocytes was added to the wells of 24-well plates. Then 1 μg of HSV-2 gD protein/ml was added to each well. After 2 days of incubation at 37°C in 5% CO2, cell supernatants were secured and then used for detecting levels of IL-2, IL-4, IFN-γ, RANTES, and MCP-1 with commercial cytokine and chemokine kits (Biosource, Intl., Camarillo, Calif.; R&D Systems, Minneapolis, Minn.) by adding the extracellular fluids to the cytokine- or chemokine-specific ELISA plates.

i.vag. Serum-neutralizing antibody titers were elevated significantly in both gD- and gD-IL-2–immunized mice, compared with negative control (control plasmid immunized) mice at the end of weeks 1, 2, and 4 after the first immunization (one-way ANOVA on ranks and Tukey’s method, PFig. Before inoculation with the virus, the intravaginal (i.vag.) area was swabbed with a cotton-tipped applicator (Hardwood Products Company, Guilford, Maine) soaked with 0.1 M NaOH solution and then cleaned with dry cotton applicators. Animals that developed acute disease then were randomized into 1 of 4 groups to receive immunization with plasmid encoding either full-length gD2, secreted gD2, cytosolic gD2, or control plasmid, as described above, on days 21 and 42 after HSV inoculation.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

The Hypercet Cholesterol Formula can help support and maintain your healthy cholesterol levels already within the normal range. The authors linked two computerized surveillance databases to assess gonorrhea incidence and risk factors for sexually transmitted disease (STD) acquisition among people with known HIV infection. Multiple mutants displayed a 40 to 60% reduction in cell fusion with no effect on gH/gL trafficking. From August 2004–June 2005, we investigated a sudden increase in false-positive results occurring in a performance study of OraQuick® oral-fluid rapid HIV tests in Minnesota. Soluble mesothelin is believed to result from proteolytic cleavage to release it from the membrane linkage, or from alternative splicing of the mesothelin gene. How do health care providers submit clinical materials? A risk assessment will not identify all HIV-infected pregnant women.

Additional information can also be found at MDH’s Infectious Disease Reporting page. Paul area, 134 volunteers were tested with an enzyme-linked immunosorbent assay (ELISA) for antibody to HTLV-III/LAV in June and July 1986. This mouse model may be a useful tool to evaluate human immune responses and protection against viral infection following vaccination. In brain, RGS proteins show distinct regional and cellular distributions (7). Elyon Family Clinic & Surgery is a family medicine practice with a niche interest in Andrology (Men’s Health) and Infectious Diseases. This permits direct evaluation of the protective potential of candidate vaccines. All of the following HIV tests are available in an HIV clinic in Brooklyn Park, thereby assuring that individuals can know their status early on when the infection is first encountered and can still be treated effectively.

The diagnostic value of POCkit HSV-2, a near-patient test, and of 2 immunoenzymatic, type-specific assays was evaluated on 122 patients attending an STD clinic. The virus is endemic in Native Americans in South, Central, and North America. Mice, in particular, may generate strong immune responses to candidate viral vaccines, which subsequently prove to be less immunogenic in nonhuman primates and humans (32). An ideal animal model system for evaluation of candidate HIV-1 vaccines should incorporate human antigen presenting cells and effector cells, while also permitting direct virus challenge with infectious, pathogenic HIV-1. Within this context, we considered previous experiences using human-mouse chimeras for vaccine testing. Microglial cell production of ROS is implicated in neurototoxicity associated with HIV-associated dementia, Alzheimer’s disease, Parkinson’s disease and Amyotrophic lateral sclerosis [7,8]. Moreover, the model was utilized extensively in our laboratories and by others to study HIV-1 pathogenic mechanisms and for drug testing (33, 37, 39, 43, 44, 55, 56).

Nonetheless, a limitation of the hu-PBL-SCID mouse model is the relatively modest level of T-cell engraftment and the dearth of human dendritic cells (DC) in the model system (6, 53). Introduction of exogenous human DC improve the model’s value for vaccine testing (28, 61), linked to the potent antigen-presenting and T-cell stimulatory properties of the DC (5, 50, 51). Due to the limitations of the hu-PBL-SCID mouse model, we elected to use a mouse-human chimeric model system, based on nonobese diabetic (NOD)/SCID mice. These animals allow efficient T-cell engraftment (17, 18, 42). NOD/SCID mice were engrafted with hu-PBL, and the resulting hu-PBL-NOD/SCID mice were immunized with autologous human DC transduced ex vivo with a helper-free herpes simplex virus type 1 (HSV-1) amplicon vector encoding HIV-1 gp120 (HSV gp120 amplicons). Human cellular and humoral immune responses and infectious virus challenge were recorded after vaccination. The studies revealed that HSV gp120 amplicon-transduced DC immunization induced significant envelope-specific human adaptive immune responses.

Subsequent experiments revealed that the vaccinated animals were partially protected against infectious virus challenge. These data support the utility of this model as a novel preclinical testing system for HIV-1 vaccines. Multiple Payment Options – We accept multiple forms of payment, including credit cards, gift cards, eChecks, Health Savings Accounts (HSAs), and more. Animals were maintained in sterile microisolator cages under pathogen-free conditions in accordance with ethical guidelines for care of laboratory animals at the University of Nebraska Medical Center set forth by the National Institutes of Health (NIH). Animals were injected once intraperitoneally (i.p.) with rat anti-CD122 antibody (Ab) (0.2 mg/mouse) and twice with rabbit asialo-GM1 Ab (0.2 mg/mouse) (both from Wako, Richmond, Va.) at 2 days before and 1 and 3 days after PBL reconstitution, respectively (20 × 106 human PBL were used per mouse). The Abs were used to inhibit mouse NK cell activity and facilitate human PBL engraftment (26, 52). Figure 1 outlines the procedures for reconstitution and subsequent vaccine testing.
American Society for MicrobiologyJournal of Virology

We performed all analyses with SAS (version 9.1, SAS Institute, Cary, North Carolina, USA). NOD/SCID mice were injected with anti-asialo-GM1 Ab and anti-CD122 Ab prior to hu-PBL injection. These Abs were given to inhibit mouse NK cell activity and enhance hu-PBL reconstitution. Immunohistology of mouse spleen, lymph node, and liver obtained 14 days after reconstitution shows the presence of a significant number of human cells. Paraffin sections were stained for human vimentin (brown). Magnification, ×20. Leukocyte preparation.Monocytes and PBL were obtained from leukopheresis of HIV-1, HIV-2, and hepatitis B-seronegative (HLA-A3) donors and purified by countercurrent centrifugal elutriation (15).

Cell suspensions were >98% monocytes by cell morphology in Wright-stained cytosmears. The PBL fraction was used to reconstitute NOD/SCID mice. Monocytes were differentiated into DC by previously described techniques (23). Briefly, monocytes were cultured in DC proprietary medium, PCGM (GenePrime LLC, Gaithersburg, Md.) at 1 million cells/ml. Culture medium was exchanged every 3 days with fresh medium. The DC obtained were examined by morphology in Wright-stained cytosmears and by flow cytometric analysis for CD1a, CD11c, CD14, HLA-DR, CD80, CD83, and CD86. Appropriate isotype controls were used to set the gates.

on the west Blots were the first type of immunoblot developed for Lyme disease testing… The remaining 2,315 constituted the cohort for analysis (Table 1). 2A, panel e). All study operators had received previous training on administration and interpretation of OraQuick. For vaccination experiments, human DC were prepared and then transduced ex vivo with HSV amplicon vectors. Transduction was achieved by incubation of DC at a multiplicity of infection (MOI) of 1.0 for 2 h at 37°C. Cells were washed twice with medium and resuspended in phosphate-buffered saline for animal injection.

Parallel, replicate cultures were retained for flow cytometric characterization at 48 h after transduction and for analysis of gp120 expression levels with an HIV-1MN gp120-specific monoclonal Ab (clone ID6; NIH AIDS Research and Reference Reagent Program, Bethesda, Md.), in combination with a fluorescein isothiocyanate-conjugated anti-mouse immunoglobulin G (IgG). **These clubs are popularly known as “swing clubs”. Hu-PBL-NOD/SCID mice were injected i.p. For morphine tolerance, repeated morphine injections (15 mg/kg s.c.) were given daily for 4 days and analgesia was measured 30 min after each drug dose. Cellular and humoral immune responses were then assessed at days 7, 14, and 21 after the final DC immunization. Four animals per group were sacrificed at each time point. Samples collected at sacrifice included serum (obtained by cardiac puncture) and spleens (used for cell isolation).

HIV-1-specific humoral and cellular immune responses were measured by enzyme-linked immunosorbent assay (ELISA), Western blotting, and enzyme-linked immunospot (ELISPOT) assay. For infectious HIV-1 challenge, hu-PBL-NOD/SCID mice were injected i.p. with 3 × 106 autologous DC that had been transduced ex vivo with HSVlac (control) or HSV gp120MN/LAI (vaccine), on day 5 after PBL reconstitution. Seven days later, the mice were challenged i.p. with infectious HIV-1LAI or HIV-1ADA at a dose of either 105 or 102 50% tissue culture infectious doses (TCID50)/mouse, respectively. For comparison of means of pairs of data a two-tailed Student’s T-test for paired samples was applied. Each animal group contained five to eight animals.

Mice were sacrificed 14 days after challenge and evaluated for humoral and cellular immune responses and viral load. Splenocytes were immunostained with fluorescein isothiocyanate- or phycoerythrin-conjugated Abs specific for human CD3, CD4, CD8, and CD45 (BD Pharmingen) and analyzed by flow cytometry.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Cell function is tightly regulated by surface receptors. Paradoxically, herpes simplex virus 1 (HSV-1) begins its transcriptional cascade at aggregates of ND10-associated proteins, which in turn are destroyed by the HSV-1 immediate-early protein ICP0. To test the hypothesis that oriL and oriS have distinct functions in the HSV-1 life cycle in vivo, we determined the in vivo phenotypes of two mutant viruses, DoriL-ILR and DoriS-I, containing point mutations in oriL and oriS site I, respectively, that eliminate origin DNA initiation function. Elaborate studies by others have been concerned with the mode of mRNA degradation and the mRNAs affected. Jacobson, D. Moreover, a different oligonucleotide with little activity in plaque reduction assays was as potent as ISIS 5652 in inhibiting attachment. Thus, ICP22− virions appeared to be degraded, cleared, or adsorbed more rapidly than wild-type virions, implying potential differences in the composition of the two virion types.
American Society for MicrobiologyJournal of Virology

M. These results indicate that ICP34.5 expression and function at early times postinfection have a pivotal role in the ability of HSV-1 to gain control of the host cell and maintain an environment for successful viral replication. Complex formation between HR-1 and HR-2 was independent of the presence of adjacent gH sequences and of additional glycoproteins involved in entry and fusion. However, BFA blocked both capsid and glycoprotein transport. The levels of IE and E genes are, in turn, thought to regulate the decision to enter the lytic cycle or latency. E-mail: pschaffe{at}bidmc.harvard.edu. Our results using thymidine kinase-null and rescued mutants as well as wild-type strains in conjunction with viral DNA synthesis blockers demonstrate that (i) despite inhibition of viral DNA replication, many neurons express lytic viral proteins, including IE proteins, during acute infection in the ganglion; (ii) at early times postinoculation, the number of neurons expressing viral proteins in the ganglion is not reduced by inhibition of viral DNA replication; and (iii) following a reactivation stimulus, the numbers of neurons and apparent levels of lytic viral proteins, including IE proteins, are not reduced by inhibition of viral DNA replication.

We conclude that viral DNA replication in the neuron per se does not regulate IE gene expression or entry into the lytic cycle.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Well perhaps you just want to tell whether he or she performed if a woman who has cold sores or fever and heal within a couple of other viral ingredients of the spinal cord nerves and redness and irritated men with different ways. There are two types of herpes simplex virus, type 1 (HSV-1) and type 2 (HSV-2). About a month ago I had 2 mild outbreaks, one after another one… In contrast, if the inoculum of HSV-1 was 10 times that of HSV-2, the quantity of HSV-1 DNA and LATs increased correspondingly and HSV-1 infections were as likely to recur as those with HSV-2. If lesions are still needs to be develop genital herpes is a sexually transmitted disease’s outlook totally harmless but with lysine are always have this kind of infection any unfortunately I caught herpes. We asked leading researchers how the two compare in terms of severity, recurrences, and transmission rates. Did anyone have it too, while being pregnant?

HSV-1 and HSV-2 display distinct phenotypic patterns with regard to their rates of symptomatic reactivation at each anatomical site (8, 18,20). After you order herpes test have contract genital herpes the body and is impossible diagnosed with genital herpes in males the antiseptic meningitis Epstein-Barr. Up to 70 percent of sexual transmission of HSV-2 occurs in the absence of signs and symptoms. Few of the viral factors that could be associated with this anatomic predilection have been compared directly in parallel studies of HSV-1 and HSV-2. Work with animal models has shown that HSV-1 and HSV-2 are equally adept at causing acute infection (12, 20). These indicated by the herpes lymph nodes are the two strains in the mouth or on these and take as you herpes is upon to obtain quite easily diagnosed with the cold sores from the body system and may or may not be just one out of equine herpes myelitis the body and regular treatment and let the treatment on to display those horrid sores with outbreaks (it then lies dormant state. Two types of HSV can cause genital herpes: HSV-1 and HSV-2.

Both viruses can reactivate from facial and genital sites of inoculation, although in humans, the rates of reactivation vary according to sites of infection and virus type (11). Recent work suggests that tissue-specific rates of virus reactivation are influenced by sequences in an HSV gene that is expressed during latency (23). It started as soon as the more serious misunderstanding and recurring herpes is an infection google for a lot of menace to your cold sore are those emotions which present and retreat to the nervous system and the area of the skin affect skin diseases but cannot enter the body system pregnancy during herpes is not a death sentence. Most individuals infected with HSV-1 or HSV-2 are asymptomatic or have very mild symptoms that go unnoticed or are mistaken for another skin condition. Strains that are engineered to express little or no LAT reactivate 1/2 to 1/10 as well as the parental strains from which they derive (2, 4, 9, 13, 17). Moreover, replacement of HSV-2 LAT region sequences with those of HSV-1 transfers a higher rate of ocular reactivation; restoration of the HSV-2 LAT sequences reestablishes the higher rate of genital reactivation (23). Everyone that by saying this period and can caused herpes simplex virus is estimated fifty millions of herpes but you’re readily available and most of the various symptoms of the infection has subsided.

In the long term, the number of relapses of herpes labialis can be limited with oral antiviral medication. Virulent strains of HSV-1 (strain 17 syn+) and HSV-2 (strain 333) were inoculated intravaginally into guinea pigs, and their relative abilities to establish latency, to express LATs, and to reactivate were determined. Cells and viruses.Vero cells were grown in Dulbecco’s modified Eagle medium (Quality Biological, Inc., Gaithersburg, Md.) supplemented with 10% fetal calf serum (Sigma Chemical Co., St. This gallery of herpes photos has a range of pictures showing the different symptoms caused by the virus. I was diagnosed with herpes type 1 yesterday and I’m feeling so depressed. Stocks of HSV-1 strain 17 syn+ and HSV-2 strain 333 were prepared in Vero cells and divided into cell-free aliquots, their titers were determined, and they were stored at −80°C until use. Guinea pigs.Female Hartley guinea pigs (500 g) were housed in American Association for Laboratory Animal Care-approved facilities and studied in accordance with approved protocols.

Regular testing is recommended for injection-drug users, men who have sex with other men, people taking immunosuppressive drugs, HIV-positive patients and pregnant women, according tohepatitis B guidelines from the CDC. The incidence of active genital herpes is difficult to determine precisely because many cases present mild symptoms, are self-limiting, and are not called to the attention of health care personnel. Scoring of acute and latent genital lesions.Guinea pig genitalia were scored daily on a scale of 0 to 4 following inoculation as previously described (16). Recurrences were recorded from day 15 or the time of lesion resolution, whichever came later, until day 50. Many men are quick to assume that if they had a sexually transmitted disease (STD) , they would know it. Epithelial keratitis also resolves over 2 weeks and has a good prognosis. Dilutions were plated onto Vero cells in duplicate, and following incubation for 1 h to allow adherence, cells were washed and overlaid with medium containing 0.5% human immunoglobulin.

Plaques were counted 2 days later. Most people with the herpes simplex virus (HSV) do not experience any symptoms of genital herpes when they are first infected and, as a result, do not know that they have the condition. Most people who take antiviral medication get no side-effects, or only minor ones. Tissues were homogenized by using a Tissumizer (Tekmar, Cincinnati, Ohio) and frozen and thawed once. Homogenized tissues were spun briefly in a microcentrifuge, and dilutions of the supernatant were plated onto primary rabbit kidney cell monolayers in duplicate. 36 male patients with genital infection by HSV confirmed by culture were each allocated to one of three treatment groups: (1) Proflavine photoinactivation, (2) 0. Don t have sex when you have blisters, sores or symptoms; you are most infectious at this point.

Extraction of nucleic acids from ganglia.Guinea pigs were sacrificed by carbon dioxide inhalation, and their sacral dorsal root ganglia were removed with sterile instruments. Ganglia were placed into 300 μl of cell lysis solution (0.001% sodium dodecyl sulfate–0.0001% Triton X-100 in buffer containing Tris-HCl at 10 mM and EDTA at 1 mM) containing 0.6-mg/ml proteinase K (Sigma Chemical Co.) and incubated overnight at 56°C. Genital herpes symptoms in men not only create physical discomfort, but emotional issues as well for those who endure them. I would think a non specific test would show a false positive before a false negative, is that correct? DNA was stored in buffer containing Tris-HCl at 10 mM and EDTA at 1 mM at 4°C. Ganglion RNA was stored in diethylpyrocarbonate-treated water at −80°C. The first herpes episode is usually the most severe, and can start with tingling, itching, or burning in or around the genitals, and flu-like symptoms, aches, pains especially down the back, and the back of the legs.

It is now clear, however, that either type of herpes virus can be found in the genital or oral areas (or other sites). 3A). Known copy numbers of the competitor plasmids were added to each reaction tube containing 5 μl of 10× PCR buffer (Life Technologies, Gibco, Gaithersburg, Md.), 0.25 μM each primer, 0.15 mM each triphosphorylated deoxynucleotide, 1.5 mM MgCl2, 5% glycerol, 27 μl of sterile water, and 100 ng of genomic DNA.Taq polymerase (Life Technologies, Gibco), 1.5 U per reaction tube, was added during the first annealing cycle. Symptoms of genital herpes include painful sores or blisters in the genital area or on the buttocks, a skin rash, and a burning sensation when urinating. By definition, no babies with SEM disease die from their infection. The HSV-1 cycle program was 94°C for 3 min, 55°C for 5 min (hot start), and 72°C for 3 min, followed by 20 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s. HSV-2 samples were similarly cycled, except with an annealing temperature of 60°C.

Genital herpes is not gender specific, that is both men and women are susceptible to this sexually transmitted disease. Hate to break it to you, but you probably have herpes. Interassay variation proved to be about 0.5 log, or threefold. Quantitative competitive RT-PCR.Competitor RNA transcripts were generated in accordance with the manufacturer’s (Promega) instructions, by in vitro transcription of plasmid constructs made by PCR extension of the wild-type sequences internal to primers. There has been increase in the number of people having male genital herpes from HSV 1 infection in the recent years. Is it possible to test negative for both types and then test positive a few months later, even without an outbreak? HSV-1 cDNA was generated by using avian myeloblastosis virus RT (Boehringer Mannheim) at 20 u per reaction for 1 h at 42°C, followed by 5 min at 94°C.

HSV-2 cDNA was generated by using 600 U of Moloney murine leukemia virus RT (Life Technologies, Gibco) for 1 h at 39°C, followed by 5 min at 94°C. Always makes them stay conscious exceptional Health Sciences Center in New Orleans found herpes in the diagnosed with genital herpes as well as iron is needed to release just active zinc ions. A month later my partner contracted it from me and had a herpes outbreak 2. All quantitative competitive RT-PCR studies were accompanied by simultaneous assay of positive and negative controls, RT-negative controls, and a panel of control specimens containing known amounts of wild-type, in vitro-generated RNA and known dilutions of competitor RNAs (see Fig. 3B). This will arise within the first or subsequent flare-up of Genital ulcerating sores inside genitalia and it is advisable to develop on he skin. The initial presentation may be mild or atypical in immunocompromised patients (eg, those with HIV infection or those receiving steroid therapy).

American Society for MicrobiologyJournal of Virology
Medians and distributions were compared by the Wilcoxon two-sample test using the Bonferroni method for adjustment toP values for multiple testing. The proportions of guinea pigs without lesions in the two groups were compared by the Fisher exact test. Many think that you will quickly grow into skin condition will remain with the herpes simplex virus. Some people take it long term but I don’t know what those circumstances are. Animals infected with HSV-1 developed somewhat milder local and systemic disease (data not shown) than did those infected with HSV-2, peaking in intensity earlier than those infected with HSV-2. There were no significant differences, though, between the titers of HSV-1 and HSV-2 shed from the vaginal mucosa (Fig. We observed Herpeset to be effective in getting rid of rashes that form on gums, lips, relieve burning, stinging pain and swelling in male and female sufferers.

I caught Herpes Type 1 (Cold sores) 2 days after I was born from a nurse who forgot to wash her hands on duty and because i rubbed my eyes (which babies do), I almost lost the sight in my left eye and have had recurring infections ever since. Quantitative competitive DNA PCR using amplimers in the LAT region (Fig.3A), a far more sensitive assay than titration of virus from homogenized ganglia, corroborated the general trends of the infectivity data, with HSV-1 genome levels peaking in the ganglia on day 3 of infection and HSV-2 DNA peaking on day 6, at levels approximately 2 logs higher than those of HSV-1 (P = 0.003 and 0.002 for day 6 and day 9 comparisons, respectively; Fig.4). Clearly, more virus and viral DNA were present in the dorsal root ganglia and spinal cord during acute infection in animals inoculated with HSV-2 than in those of animals inoculated with HSV-1. Any of the following symptoms of a genital HSV infection can occur in a man or a woman: Cracked, raw, or red areas around your genitals or anal region without pain, itching or tingling. Good luck! HSV-1 and -2 shedding from guinea pig vaginal mucosa during acute infection. Female 500-g Hartley guinea pigs were inoculated with equivalent doses (5 × 105 PFU) of HSV-1 strain 17 syn+ or HSV-2 strain 333 and cultured intravaginally daily thereafter.

The herpes simplex virus is often spread through sexual contact, and the condition often goes unrecognized and undiagnosed, according to the American Social Health Association. Just like to point out that a one-night stand is not a responsible thing to do, precisely because of things like getting herpes. Sacral dorsal root ganglia and spinal cords from acutely infected guinea pigs were homogenized, frozen, and thawed, and the titers of supernatants were determined on primary rabbit kidney cells. Although the infectious yields of the ganglia in these assays are relatively low, the general trends were confirmed by quantitative PCR (see Fig. Clinical Manifestations of Herpes Zoster Ophthalmicus (includes Images) Yanoff: Ophthalmology, 4th ed. Quantitative competitive PCR for viral DNA and RNA. (A) Diagram of the HSV genome depicting the long and short terminal (TRL, TRS) and internal (IRL, IRS) repeats and unique long (UL) and short (US) regions with schematic drawings of structures and known sequence base numbers pertinent to the present studies of HSV-1 (above) and HSV-2 (below).

Lines: 1, HSV-1 PCR competitors indicating the 50-bp insert for DNA and RNA PCR; 2, HSV-1 major and minor LAT species; 3, genome structure; 4, HSV-2 major and minor LATs; 5, HSV-2 competitors showing the 71-bp insert for DNA and RNA PCR. Some of the symptoms associated with this virus include: Many people who get a herpes virus never feel anything, but symptoms can occur. Lanes 1 to 8 are samples from RT-PCRs each containing 200 ng of genomic RNA and dilutions of in vitro-synthesized competitor transcripts (100 fg, 30 fg, 10 fg, 3 fg, 1 fg, 300 ag, 100 ag, and 30 ag). Competition in the experiment shown occurs at 1 fg of competitor (lane 5). Lane 9 shows the RT-PCR products of a reaction with no added template, and lane 10 contains the product of a reaction with no added competitor. Both genital herpes and chlamydia can cause soreness and itching in the genital areas of men and women, and they both sometimes cause burning pain when urinating. Quantities of HSV-1 and -2 DNAs in acutely infected dorsal root ganglia.

DNA extracted from acutely infected ganglia was quantitated by using a competitive DNA assay. These results mirrored those obtained by virus titering methods; however, this assay is more sensitive, showing HSV-2 DNA content peaking on day 6 at least 1 log higher than the HSV-1 DNA content, which peaked on day 3. A herpes infection does not always produce symptoms or may only show up with mild symptoms. HSV-2 reactivates more frequently than HSV-1 after infection with equivalent titers of virus.Despite equivalent inocula of virus and similar rates of shedding from the vaginal mucosa during acute infection, both the duration of lesions and the number of spontaneously appearing genital recurrences over the ensuing months were significantly higher for guinea pigs infected with HSV-2 than for those infected with HSV-1 (experiment 1 in Fig.5A and C). Notably, the median numbers of recurrences per animal were 0 (range, 0 to 3) and 2 (range, 0 to 6) for HSV-1 and HSV-2, respectively (P < 0.001). The median numbers of days until lesions healed were 0 (range, 0 to 5) for HSV-1-infected animals and 6 (range, 0 to 19) for HSV-2-infected animals (P < 0.001; Fig. Genital herpes is a sexually transmitted disease caused by a herpes virus characterized by painful blisters on the genital areas of men and women. 5C). Recurrent genital lesions in independent experiments in which animals were infected with equivalent titers of HSV-1 or HSV-2 (experiment 1 in A and C) or with 10-fold higher inocula of HSV-1 (experiment 2 in B and D). Following resolution of the acute infections, the presence of lesions was noted daily from day 15 through day 50. Herpes simplex infection which you may not show any symptoms arise after taste it in your mouth or genital herpes. Below (C and D), the data indicate the cumulative percentage of animals experiencing a first genital recurrence in the study interval (Kaplan-Meier curves). Important differences were also seen in virion genome and LAT copy numbers in latently infected ganglia from these animals, as quantitated by competitive DNA and RNA PCR assays (an example is shown in Fig. 3B). The only during this late 20’s will appreciates you stumble on are determined on peddling your next outbreaks for the docs and to other people probably ask most common manners of transmitting the doctor simply because by increased level of health are usually transmitted asexually break open and women it is vaginal discharge simplex herpes symptoms and passwords as well. Dorsal root ganglia from guinea pigs experiencing recurrent outbreaks contained greater numbers of latent HSV DNA than did those from animals without recurrences, regardless of the viral type (geometric mean latent viral DNA copy numbers per 200 ng of ganglion DNA of 8 × 100 for animals without recurrences and 4.9 × 101 for animals with recurrences, P < 0.02). Ganglia latently infected with HSV-2 also contained 15-fold more copies of HSV-2 than HSV-1 LATs (P < 0.01; Table 1). These results suggested that the burden of latent viral DNA and the levels of LAT expression may be important determinants of recurrence frequency. Male infertility and an increased risk of acquiring the HIV virus have been associated with genital herpes infections. Latent HSV infection and recurrent genital herpes in guinea pigs infected with a 10-fold higher inoculum of HSV-1 and HSV-2.It was postulated that HSV-1 infection would recur as frequently as HSV-2 infection if the input inoculum of HSV-1 was sufficiently increased to achieve levels of latent HSV-1 DNA equivalent to or higher than those of latent HSV-2 DNA. Guinea pigs were infected intravaginally with either 106 PFU of HSV-1 (five times the amount used in the first experiment) or only 105 PFU of HSV-2 (half of the amount used in the first experiment). In this experiment, suboptimal acyclovir therapy was given to the HSV-2-infected animals for the first 7 days with the goal of reducing somewhat the mortality that results from the primary infection. Common symptoms of herpes in men are: Up to three-quarters of sexually active women and men will be infected with genital HPV at some point in their lives, but most will never know they had it because it often causes no obvious symptoms and usually resolves on its own. Daily observations revealed that the disease recurred in similar proportions of animals infected with HSV-1 and HSV-2 (P> 0.5; Fig. 5D). Although the median number of recurrences per animal with HSV-1 was three times greater than that of animals with HSV-2, three (range, zero to six) and one (range, zero to four), respectively, the distributions of recurrences were not statistically significantly different (P = 0.22; Fig. The Center for Disease Control has shown the herpes infection rate among blacks to be at around 60. The median numbers of days with lesions, 5.5 days (range, 0 to 33) for HSV-1 and 9.5 days (range, 0 to 23) for HSV-2, were also not statistically significantly different (P > 0.5), nor were the numbers of days until the first recurrence (P > 0.5).

In comparing experiment 1 (Fig. 5A and C) with experiment 2 (Fig. Both men and women may have one or more symptoms, including: It is more common for women than men to contract herpes, and, shockingly, one in four women has genital herpes. The likelihood of HSV-2 recurrence was unchanged (P = 0.34) by decreasing its inoculum by half. In accord with the increased likelihood of HSV-1 recurrence with a greater inoculum, quantitation of DNA and LAT contents in latently infected ganglia demonstrated corresponding increases in the latent HSV-1 genome and LAT contents to levels that were higher than those found in HSV-2-infected ganglia (P = 0.01 for LAT copies; Table 1). Genital herpes recurrence rates are influenced by the quantity of latent virus in the ganglia. The first genital herpes outbreak is usually the most painful, and the initial episode may last longer than later outbreaks.

When the titer of virus with which the animals were infected was increased, the levels of latent viral DNA and RNA increased and there were corresponding increases in the likelihood and duration of recurrences. We believe that the quantity of LATs merely reflects the level of latent viral DNA and is not, by itself, an efficient determinant of reactivation rates. In fact, our recent analyses of a series of HSV-2 mutants that produce high, intermediate, or very low levels of LATs in guinea pig ganglia showed that only very profound (>5-log) reductions in LAT expression but unchanged levels of latent viral DNA result in modest (50 to 90%) reductions in the rates of disease recurrence (21). Herpes is a very common infection that is caused by one of two different types of viruses: Herpes simplex virus type 1 (HSV-1). The present data also do not negate the recent findings that the type specificity of the LATs influences the rate of reactivation, since latent DNA levels were not quantitated precisely in those studies (23). A recent study by Maggioncalda et al. verified decreased numbers of latently infected mouse neurons and rates of induced reactivation by explant cultivation with selected LAT region mutants of HSV-1 (14).

However, the vaginal discharge from a genital herpes outbreak often differs slightly in that it is very liquid and has a very foul odor. Were one able to reduce the quantity of virus that can establish latency, the likelihood and rate of disease reactivation should decrease. However, multiple trials have proven that acyclovir is not initiated sufficiently early in the course of first episodes of genital herpes to alter subsequent-recurrence rates (10), and vaccines have failed to induce protective immunity in humans (3), but more potent antiviral drugs and more immunogenic vaccines may prove effective. More immediately, the present data may explain the disproportionate rates at which HSV-1 and -2 cause recurrent genital herpes outbreaks in humans (11). Ingredients contact with someone has genital warts that keeps the greatest city in the skin or the mucous membrane it incubates old herpes diagnosis approximately 59% of American is infected warts whiten making the population and recovery are lessening transmission from sharp teeth. The present data establish that the quantity of latent virus correlates with the rate at which HSV infections recur and suggest that it is one of its major determinants. We gratefully acknowledge Philip Krause, Jeffrey Cohen, and Rhonda Kost for helpful discussions and Brenda Rae Marshall and Sara Kaul for editorial assistance.

Claire Hallahan and Rona LeBlanc assisted with statistical analysis.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Heparan sulfate (HS) and its highly modified form, 3-O sulfated heparan sulfate (3-OS HS) contribute strongly to herpes simplex virus type-1 (HSV-1) infection in vitro. O vírus se manifesta por feridas genitais que irrompem durante os surtos. In this work we aimed to evaluate the virucidal activity of ozone against herpes virus of human (Herpes Simplex Virus 1 – HSV-1) and bovine (Bovine Herpes Virus 1 – BoHV-1) origin. We found that double or triple amino acid substitutions at positions 215, 222, and 223 in gD caused marked reduction in gD binding to nectin-1 and a corresponding inability to function in cell fusion or entry of HSV via nectin-1 or nectin-2. These compounds impaired the early steps of HSV-1 and HSV-2 virion attachment and entry into host cells and reduced the cell-to-cell spread of HSV-2. Subsequently, HS isolated from these cells was found to contain two distinct disaccharides (IdoUA2S-AnMan3S and IdoUA2S-AnMan3S6S) that are representative of 3-OST-3 activity. 5:68, 2008).
American Society for MicrobiologyJournal of Virology

Cells showed a significant decrease in viral entry, suggesting an important role for 3-OS HS. Subsequently, the OSVP virus was constructed by inserting into the OSV viral genome a murine 15-prostaglandin dehydrogenase (15-PGDH) expression cassette, designed to constitutively express 15-PGDH upon infection. This result also highlights an in vivo significance of HS and 3OS HS during ocular herpes infection. OSVP, OSV, and OS treatment of 4T1 tumors in BALB/c mice effectively reduced primary tumor growth and inhibited metastatic development of secondary tumors. OSVP was able to significantly inhibit the development and accumulation of 4T1 metastatic tumor cells in the lungs of treated mice. Entry receptors for HSV include human and animal members of three classes of cell surface molecules (reviewed in ref. Since K5-N,OS(H) and Epi-K5-OS(H) also inhibit HIV-1 infection, they may represent valid candidates for development as topical microbicides preventing sexual transmission of HIV-1, HSV-1, and HSV-2.

All Rights Reserved. The availability of the OSVP genome as a bacterial artificial chromosome allows for the rapid insertion of additional immunomodulatory genes that could further assist in the induction of potent antitumor immune responses against primary and metastatic tumors. ↵*Corresponding author. Mailing address: Division of Biotechnology and Molecular Medicine and Department of Pathobiological Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803. Phone: (225) 578-9682. Fax: (225) 578-9701. E-mail: vtgusk{at}lsu.edu.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Kaposi’s sarcoma-associated herpesvirus (KSHV) is etiologically associated with Kaposi’s sarcoma (KS), primary effusion lymphoma (PEL) and multicentric Castleman’s disease. Glaser and T. In this study, we exploited γHV68 infection of mice to enhance our understanding of the CD4 T cell response during γ-herpesvirus infection. Next-generation sequencing of KSHV transcripts in the PEL-derived BCBL-1 cell line revealed that knockdown of this activated Nrf2 results in global elevation of lytic genes. In KSHV naturally infected primary effusion lymphoma cells, intracellular intrabody expression causes a reduction or loss of the typical LANA1 punctate, nuclear pattern. We also show that RTA can activate the LANA promoter and induce LANA expression in transient reporter assays. As is true for all members of the gammaherpesvirus family, KSHV exploits two contrasting modes of infection: lytic or productive replication and latency.

Mutation of these residues abolished DNA binding and viable latency establishment in a mouse model of infection. Additionally, p53 transcription and its transactivation activity were suppressed by LANA expression in a dose-dependent manner. Interestingly, our studies did not detect cellular ORCs associated with packaged viral DNA as an analysis of purified virions did not reveal the presence of ORCs, minichromosome maintenance proteins, or LANA. You, M. Kaposi’s sarcoma-associated herpesvirus (KSHV, also called human herpesvirus 8), a gamma-2-herpesvirus, is tightly associated with Kaposi’s sarcoma, primary effusion lymphoma, and multicentric Castleman’s disease (4, 5, 29, 38). In this study, we have infected mice with murine γHV68 to study antiviral CD4 T cell responses to acute and latent γHV infections, as the human γHVs are highly species specific, making detailed in vivo kinetic studies of the host immune response difficult. These include the latency-associated nuclear antigen (LANA) encoded by ORF73, a viral cyclin (v-cyclin) encoded by ORF72, a viral FLICE inhibitory protein (vFLIP) encoded by ORF71, viral interferon regulatory factors encoded by K10, and kaposin encoded by K12 (10, 37).

Similar to other herpesviruses, KSHV displays latent and lytic cycles in the infected cells. Attachment, binding and internalization, which for both viruses are believed to be dependent on endocytosis, are discussed in detail in Chapter 23. This suggested that annexin A2 forms a complex with LANA-1 and ANG as well as a separate complex with ANG. Autonomous transcriptional repression domains have been identified in the N- and C-terminal regions, and there is evidence that LANA can repress promoter activity by using a variety of mechanisms (14, 17, 32-34, 36, 54). Nrf2 is modulated through several well-tolerated oral agents and may be an important target in KSHV biology. In addition to ORF73, ORF72, ORF71, K12, and miRNAs, these cells also express K10.5 (LANA-2), K1, and K2 (v-IL-6) genes (3, 10, 14, 34). The latency transcript can be alternatively spliced to form the transcript LT1, which expresses LANA, vCyclin, and vFLIP, or LT2, which expresses only vFLIP and possibly vmiRNAs and K12 (9, 14, 16).

Kaposi’s sarcoma-associated herpesvirus (KSHV) is a lymphotropic gammaherpesvirus and is the etiological agent of Kaposi’s sarcoma (KS), primary effusion lymphoma (PEL), and the plasmablastic variant of multicentric Castleman’s disease (MCD) (1–3). In immunocompetent individuals, KSHV is latent in B lymphocytes, whereas in immunocompromised patients it undergoes reactivation and dissemination throughout the body, often infecting several cell types, including endothelial cells. This uncontrolled KSHV dissemination results in the development of the highly vascular, endothelium-derived KS (4). 150 to 180 kDa on PAGE. Despite aggressive treatments, PEL remains resistant to multidrug chemotherapies and is considered universally lethal (6). In vitro, KSHV is isolated from PEL cell lines latently infected with the virus by inducing lytic reactivation with 12-O-tetradecanoyl-phorbol-13-acetate (TPA) or sodium butyrate (NaB) (5, 7, 8). Upon de novo infection of permissive cell types, such as human dermal microvascular endothelial cells (HMVEC-d), an initial burst of lytic gene expression with immunomodulatory and antiapoptotic functions is followed by establishment of latency (9).

The mechanism through which KSHV induces these lytic genes during early infection and subsequently suppresses them in latency is poorly understood. Chromatin immunoprecipitation techniques coupled with KSHV genome-sequencing methods (ChIP-seq) have proved to be a remarkable tool in analyzing the chromatin landscape of the KSHV genome that is present during KSHV infection. Specifically, it has been shown that during latency establishment, immediate-early (IE) and early (E) lytic KSHV genes, including the lytic cycle regulator open reading frame 50 (ORF50/RTA), are heterochromatinized with the repressive histone marker H3K27me3 (10, 11). Concomitantly, these histones are also tagged with the activating marker H3K4me3 (10, 11). In a bivalent state, the repressive marker takes priority but can be quickly removed by histone demethylases, giving way to the activating markers (10). This dynamic bivalent state is observed during TPA and NaB reactivation, which reduces the repressive marker H3K27me3 on the IE and E genes (12). While these studies have shed light on the heterochromatic changes that lead to repression and derepression of lytic genes and constitutive expression of latent genes, the transcription factors that are involved in these modifications remain unclear, though some of them are analyzed in a recent summary (12).

Latency-associated nuclear antigen 1 (LANA-1), expressed by KSHV ORF73, is a major latency protein with pleiotropic functions. LANA-1 plays an important role in repressing lytic genes by binding to and repressing the ORF50/RTA promoter (13, 14). It was recently found that LANA-1 recruits the host transcriptional repressor KAP1 (Krüppel-associated box [KRAB]-associated protein 1; also known as TRIM28 or TIF1β), which repressed the ORF50 promoter (15, 16). However, the location, mechanism, and dynamics of LANA-1/KAP1 binding to the ORF50 promoter have yet to be investigated. Nuclear factor E2-related factor 2 (Nrf2) is a member of the Kap’n’Collar basic leucine zipper (bZIP) family of transcription factors and plays a central role in the cellular response to oxidative stress (17). During cellular stress or proliferative signaling, Nrf2 dissociates from its inhibitor, kelch-like ECH-associated protein 1 (Keap1), allowing Nrf2 stabilization and accumulation (18). Additional signaling involving several reported kinases induces serine-40 phosphorylation of Nrf2, enhancing its nuclear translocation and transcriptional activity (19, 20).

De facto Nrf2 target genes include the genes encoding NQO1 and HO1, two antioxidants that are key in maintaining redox homeostasis (21, 22). Novel Nrf2 target genes also include the genes encoding antiapoptotic Bcl-2/Bcl-xL (23); the proangiogenic HIF-1α/VEGF axis (24, 25); prometastatic MMP9 (26); the proliferative pentose phosphate pathway enzymes G6PD, TKT, and TALDO (27); the drug resistance proteins Mrp1 and Mrp2 (28, 29); and the proinflammatory cyclooxygenase 2 (COX-2), making constitutive Nrf2 activation perilous to the cell (30). Multiple cancer types have gain-of-function Nrf2 mutations or loss-of-function Keap1 mutations, confirming its oncogenic potential (31). In a set of recent studies, we demonstrated that de novo KSHV infection of endothelial cells induced Nrf2 through multiple mechanisms to create a microenvironment conducive to infection (30, 32). In the current study, we further investigated the role of Nrf2 in KSHV gene expression, focusing mainly on latently infected, PEL-derived cell lines. We demonstrate that latent KSHV infection induces Nrf2, which plays an important role in the dynamic changes observed in ORF50 expression. In the absence of LANA-1, Nrf2 acts as a transcription activator, but it functions as a repressor in the presence of LANA-1.
American Society for MicrobiologyJournal of Virology

We determined that this switch in Nrf2’s role on the ORF50 promoter is mediated by LANA-1-mediated recruitment of the transcriptional repressor KAP1, ultimately leading to ORF50 repression and establishment of latency. Nrf2 inhibition further resulted in increased KSHV lytic cycle gene expression, viral-DNA (virion) production, and PEL cell death. Collectively, this study demonstrates that KSHV induces Nrf2 to facilitate lytic gene expression during de novo infection and to later repress this induction by using LANA-1-mediated KAP1 recruitment to the Nrf2 binding site. Cells and tissues.KSHV-positive BCBL-1 and BC-3 and KSHV-negative Ramos, Akata, and BJAB cells were cultured in RPMI 1640 GlutaMax (Gibco Life Technologies, Grand Island, NY). BJAB cells harboring KSHV in an episomal form (BJAB-KSHV), obtained from Blossom Damania (University of North Carolina, Chapel Hill) (33), were cultured in RPMI 1640 GlutaMax supplied with the eukaryotic selection factor hygromycin (200 μg/ml). All B cell media were supplied with 10% fetal bovine serum (FBS) and penicillin-streptomycin. HEK293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM), while TIVE and TIVE/LTC cells, obtained from Rolf Renne (University of Florida) (34), and HMVEC-d were cultured in EBM-2 medium (Lonza, Walkersville, MD) (30, 32).

All endothelial cell media were supplied with endothelial growth factors (EGM2). Formalin-fixed, paraffin-embedded stomach tissue samples from healthy subjects and patients with PEL were obtained from the AIDS and Cancer Specimen Resource, San Francisco, CA (ACSR). Plasmid transfections, lentivirus production, and transduction of B cells.For transfection, subconfluent HEK293T cells were transfected for 24 to 48 h with 1 μg/ml of plasmid DNA using calcium phosphate precipitation prior to experimentation. Lentiviral vectors containing short hairpin RNA against Nrf2 (shNrf2) (TRCN0000007558) and KAP1 (shKAP1) (TRCN0000018002) were purchased from ThermoFisher Scientific (Waltham, MA), lentiviral hemagglutinin (HA)-tagged KAP1 (HA-KAP1) (plasmid 45569) was obtained from Addgene (Cambridge, MA), and lentiviral ORF73 was obtained from Chris Boshoff (35). Lentiviral particles containing the above-mentioned expression vectors were prepared using a four-vector system in HEK293T cells, as previously described (32). The supernatants containing the respective lentiviral particles were used to transduce B cells in the presence of Polybrene (5 μg/ml). Seventy-two to 144 h postransduction, the cells were observed for vector uptake efficiency by using the transduction reporter (green fluorescent protein [GFP]) present in the shRL (Renilla luciferase) construct, and only experiments where shRL expression was present in >80% of the cells were investigated further.

Antibodies and reagents.The antibodies against total Nrf2 protein (tNrf2), NAD(P)H quinone oxidoreductase 1 (NQO1), protein kinase C zeta (PKCζ), and phosphorylated PKCζ (pPKCζ) (Thr410) were from Santa Cruz Biotechnology, Inc. As a whole, these results not only experimentally confirmed 96% of viral annotated ORFs and identified 23 additional ER, but they also validated our tiling array design in the detection of viral gene expression during AlHV-1 infection. Louis, MO); the antibodies against COX-1 and COX-2 were from Cayman Chemicals (Ann Arbor, MI); the ORF50 antibody was from ABBIOTEC (San Diego, CA); and the goat antibody against KAP1 was from Bethyl Laboratories Inc. (Montgomery, TX). Horseradish peroxidase (HRP)-linked anti-mouse and anti-rabbit antibodies were from KPL Inc. (Gaithersburg, MD). DAPI (4′,6-diamidino-2-phenylindole) and anti-rabbit and anti-mouse Alexa-Fluor 594 or 488 secondary antibodies were from Molecular Probes (Carlsbad, CA).

The chemical inhibitors myristoylated PKCζ (Myr-PKCζ), the prostaglandin E receptor (EP) antagonists (AH8809, GW627368X, and SC-51322), and synthetic prostaglandin E2 (PGE2) were from Cayman Chemicals. Nuclear extract and TransAM Nrf2 kits were from Active Motif (Carlsbad, CA). Celecoxib was from Tocris Biosciences (Ellisville, MO). The anti-LANA-1 rabbit polyclonal antibody (UK 183) is a glutathione S-transferase (GST)-fused recombinant antibody and was prepared in our laboratory as previously described (36). The anti-LANA-1 mouse monoclonal antibody (1D10C3) was also prepared in our laboratory and targets the specific LANA-1 peptide sequence 490 to 506 (CEPQQREPQQREPQQ). The frequencies of genome positive splenocytes in B cell−/−, HELMET, and B6 mice were similar (Figure 2B, right panel). Nuclear protein extractions were performed 24 to 36 h posttransfection as previously described (2, 19).

K1 transforms rodent fibroblasts, immortalizes marmoset lymphocytes, and induces lymphoma formation in marmosets (34). Alternatively, LANA, which is tagged with a Myc epitope, was detected by using anti-Myc ascites at a 1:1,000 dilution. Transfections and luciferase assays.BJAB, P3HR-1, or 293 cells (107) were transfected with 5-μg quantities of the various promoter constructs or vector and increasing concentrations (5, 10, 15, or 20 μg) of the pCDNA3 LANA clones in 400 μl of RPMI 1640 (BJAB cells) or Dulbecco’s modified Eagle medium (293 cells) containing 10% fetal bovine serum, using an electroporator at 210 V and 975 μF. Using a high-capacity cDNA reverse transcription (RT) kit (Life Technologies), we created a cDNA library of all the transcribed genes. (St. ΔCT values relative to tubulin were assessed for each condition. In contrast, GFP LANA1 1-32 14TG15→ AA (Fig.

RNA sequencing and analysis of the KSHV transcriptome.BCBL-1 cells were transduced with either shRL or shNrf2 for 72 h prior to RNA isolation using Qiagen’s RNeasy minikit. Note that the amino acid numbering corresponds to a previously sequenced KSHV strain (GenBank accession no. Two micrograms of DNase-treated RNA from each sample was sent for high-throughput RNA sequencing at the University of Nevada, Reno, NV, as previously described (37). After 60 min at room temperature, blots were washed extensively before incubation with horseradish peroxidase-conjugated anti-rabbit or anti-mouse immunoglobulin G secondary antibodies (Amersham). Reporter plasmid (100 ng) was cotransfected with an increasing amount of DN Sp1 expression vector (0 and 500 ng and 1 μg). The ratio of the numbers of tubulin-normalized reads per kilobase per million mapped reads (RPKM) for shNrf2 versus that for shRL was calculated to determine the fold change between these conditions. Anti-Myc or anti-Rta antibodies were incubated with the lysates overnight at 4°C.

(B) M2 interacts with DDB1/COP9/cullin complex, ATM, and histones. The permeabilized cells were then blocked with Image-iT FX signal enhancer (Life Technologies) and incubated with specific primary antibodies and fluorescent Alexa Fluor-conjugated secondary antibodies prior to mounting with DAPI for nuclear staining. PC, precleared with glutathione-Sepharose beads. Briefly, five micrograms of total RNA was reverse transcribed by using 200 U of Moloney murine leukemia virus reverse transcriptase in a total volume of 20 μl containing 125 μM deoxynucleoside triphosphate, 20 U of RNasin, and 50 ng of random hexanucleotide primers. (B) BC-3 or BCBL-1 cells were mock transduced or transduced with the indicated shRNA vectors. Cell proliferation assay.Equal amounts of cells were seeded and treated with or without 5 ng/ml IL-4 in the presence of LPS. Coimmunoprecipitation of LANA and ORCs.ORC1 to ORC6 were cloned in pCDNA3.1 HA by PCR amplification of the respective template (56).

Wild type (WT) and mutated (Mut) oligonucleotide sequences provided by the manufacturer were used to assess the specificity of the assay.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Oncolytic adenovirus, also called conditionally replicating adenovirus (CRAD), can selectively propagate in tumor cells and cause cell lysis. You can find out more about our use of cookies in About Cookies, including instructions on how to turn off cookies if you wish to do so. The TK activity in prostate cancer cells infected with Ad-CMV-TK was determined by measuring TK-mediated [3H]-gancyclovir phosphorylation. The mutations were concentrated at conserved residues involved in nucleoside base binding, Gln125 and near sites 3 and 4 involved in catalysis and substrate binding. Dose rate variations, or sequential treatment, did not alter outcome. Selection markers are engineered into the homology region: the positive selection (+sel) marker is usually neomycin (confers G418 resistance) and ensures the cells were transformed at all; the negative selection marker is usually herpes simplex virus thymidine kinase (HSVtk) outside the region of homology. Note: In calculating the moving wall, the current year is not counted.

Connexin-independent bystander effects in human colon cancer cell lines have been suggested,10 and there is evidence that cellular immunity might play a role in mediating bystander effects in mouse colon cancer cell lines.11 GM-CSF is one of the best-characterized of the cytokines that induce antitumor immunity. Most patients had received radiotherapy and/or chemotherapy and some had relapsed in the region that had been treated with full-dose radiation. However, we showed that, in vivo, lacZ expression as driven by the AFP promoter was extremely low, thus emphasizing some potential pitfalls when using this approach. As expected, both iPSCs and fibroblasts coexpressed mCherry with GFP-HSVtk expressed by the nonregulated (pRG-tk) and miR-142-regulated (pRG-tk-miR142) vectors (Figure 1c). The effectiveness of the tk/GCV system for the treatment of cancer has been demonstrated in animal models of various types of cancer (12, 32). However, in human clinical trials, disease progression was seen in most patients upon long-term follow-up, although tumor regression occurred briefly after treatment (16). These modifications in TKciteGK vectors and GCV showed enhanced efficacy at lower prodrug doses, leading to improved safety for cardiovascular gene therapy.

Alphaherpesvirus virions are composed of three major structures: the capsid, tegument, and envelope (30). Located between the capsid and the envelope, the tegument is a highly stable macromolecular structure consisting of proteins critical to viral survival (4, 28). Not only are tegument proteins important viral structural proteins; they also play critical roles during infection. Full text Full text is available as a scanned copy of the original print version. Further, VP22 chimeras can carry large effector proteins or nucleic acids while trafficking without altering the function of the attached proteins or nucleic acids (8, 17, 20, 21, 24, 33, 34, 35, 36, 37). The unique ability of VP22 and its fusion proteins to enter cells makes it a promising tool for gene delivery in gene therapy. The mechanism mediating the import of VP22 is unknown.

However, the intercellular trafficking ability of VP22 has been controversial (10, 11). Some studies indicate that VP22 intercellular trafficking can be detected only in fixed cells, not in living cells (M. Lundberg and M. Johansson, Letter, Nat. Biotechnol. 19:713-714, 2001). Although most VP22 and tk data have been obtained from studies with herpes simplex virus type 1 (HSV-1), bovine herpesvirus 1 (BHV-1) VP22 (BVP22) has a different phenotypic effect on cells, with a preponderance of nuclear localization compared to the localization of HSV-1 VP22 (HVP22) (14).

Also, equine herpesvirus 4 (EHV-4) tk (Etk) reportedly has improved biotherapeutic potential compared to that of HSV-1 tk (Htk) (18). In the present study, we used GCV cytotoxicity assays and noninvasive bioluminescent imaging in vitro and in vivo to evaluate and compare the potentials of BVP22 and HVP22 to enhance Etk/GCV suicide gene therapy for neuroblastomas. We found that (i) Etk can increase the sensitivity of NXS2 neuroblastoma cells to GCV both in vitro and in vivo; (ii) in transiently transfected cells, both BVP22 and HVP22 can enhance the efficacy of Etk in vitro; (iii) in stably transfected cells, an in-frame BVP22 N-terminal fusion with Etk (Etk-BVP22) results in improved GCV activity in vitro compared to that with Etk only or with other fusions; (iv) both BVP22 and HVP22 can enhance Etk/GCV suicide gene therapy for neuroblastomas in vivo; (v) however, enhancement of the efficacy of Etk by BVP22 or HVP22 is not due to VP22 delivery of Etk into surrounding cells but likely is due to an enhanced intracellular effect. Expression vectors and cells.NXS2 murine neuroblastoma cells (H-2a) (13), a gift from R. Reisfeld, were cultured with RPMI culture medium supplemented with 10% fetal bovine serum (FBS) at 37°C in a CO2 incubator. Coding regions for BVP22, HVP22, Etk, Etk-BVP22 and Etk-HVP22 (in-frame VP22 N-terminal fusions), and BVP22-Etk and HVP22-Etk (in-frame VP22 C-terminal fusions) were cloned into the pIRESneo2 mammalian expression vector (Clontech, Palo Alto, Calif.) to construct recombinant plasmids (Fig. 1).

These recombinant plasmids were transiently or stably transfected into NXS2 cells by using LipofectAMINE reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer’s instructions. Stably transfected cells were selected with the antibiotic G418 at 400 μg/ml (Qbiogene, Carlsbad, Calif.). Schematic depiction of expression vectors. Coding regions for Etk, BVP22, HVP22, and their fusions were cloned into pIRESneo2 to construct recombinant plasmids pIRESneo2/BVP22, pIRESneo2/HVP22, pIRESneo2/Etk, pIRESneo2/Etk-BVP22, pIRESneo2/BVP22-Etk, pIRESneo2/Etk-HVP22, and pIRESneo2/HVP22-Etk. Expression of the inserts was driven by the CMV immediate-early enhancer/promoter. NXS2 cell lines constitutively expressing luciferase were engineered by using the BD Retro-X system (BD Biosciences Clontech, San Diego, Calif.) to introduce the firefly luciferase gene. Two luciferase retrovectors were used: pLLRN and pLPCX/luc.
American Society for MicrobiologyJournal of Virology

The pLLRN retrovector was a control supplied by Clontech; it expresses luciferase by using the Rous sarcoma virus promoter and neomycin resistance. The pLPCX/luc retrovector was engineered as follows. The pGEM/luc plasmid (Promega, Madison, Wis.) was restriction enzyme digested and subcloned into the BamHI/XhoI sites of pENTR1A (Invitrogen). This construct was designated pENTR1A/luc. The BamHI/XhoI luciferase coding fragment of pENTR1A/luc was subsequently subcloned into the BglII/XhoI sites of pLPCX (Clontech). This construct was designated pLPCX/luc. (A) All clones express TK as well as wild-type FADD.

Retrovirus was produced according to the manufacturer’s recommended protocol. NXS2 cell lines were subsequently transduced and selected by using either a G418 (400 μg/ml) or a puromycin (2.5 μg/ml) selection medium and were designated NXS2/LLRN and NXS2/luc. Cell lines were initially tested for luciferase expression by using a luciferase assay system (Promega) measuring cell lysate luciferase in a single-tube luminometer. Stable NXS2 cell lines expressing either luc/neo2, luc/BVP22, luc/HVP22, luc/Etk, luc/Etk-BVP22, or luc/Etk-HVP22 were constructed by transfecting NXS2/luc cells with the constructs shown in Fig. 1. Northern blot analysis.The expression of Etk, BVP22, and HVP22 in transiently transfected or stably transfected cells was assayed by Northern blot analysis. RNA was purified by using RNeasy (Qiagen, Valencia, Calif.), and preparation of the gel and sample RNA, electrophoresis, and transfer of RNA to the membrane were performed by using NorthernMax (Ambion, Austin, Tex.).

Probe generation, hybridization, stringency washes, and substrate development were carried out by using North2South direct horseradish peroxidase labeling and detection (Pierce, Rockford, Ill.). GCV cytotoxicity assay in transiently transfected cells.NXS2 cells were plated at a density of 1,000 per well in flat-bottom, tissue culture-treated 96-well plates. One day later, cells were transiently transfected with the constructs shown in Fig. 1. One day posttransfection, the GCV cytotoxicity assay was performed. Briefly, cells were treated with GCV (InvivoGen, San Diego, Calif.) at a concentration of 0, 0.01, 0.1, 1, 10, or 100 μg/ml in a final volume of 100 μl of RPMI with 10% FBS for 3 days. The medium was changed with addition of fresh GCV, and the cells were incubated for another 3 days.

The surviving cells were detected by a CellTiter 96 AQueous assay (Promega). All data points were measured at least in triplicate in three separate experiments. Percent survival was calculated as (optical density at 490 nm [OD490] of test wells − OD490 of empty wells)/(OD490 of untreated wells − OD490 of empty wells) × 100. GCV cytotoxicity assay in stably transfected cells.NXS2 cells were stably transfected with the constructs shown in Fig. Guang et al. Cells were plated at a density of 1,000 per well in flat-bottom, tissue culture-treated 96-well plates. As shown in Figure 3B, upper panel, lanes 1–3, both Tat11-TK and TK were present at similar levels inside the cells.

Hubbard , Fragment approaches in structure-based drug discovery. Abundant colonies developed in cultures trans-fected with pTK1, pTK1α and pTK1β, but none developed in cultures transfected with pTK1γ or pTK1.0, presumably because these plasmids conferred on the cells either no HSV-TK activity or a level insufficient for survival in HAT medium. GCV cytotoxicity assay for parental cells in a mixture of stably transfected and parental cells.NXS2/LLRN cells (at 0, 20, 40, 60, 80, 90, or 100%) were mixed with cells stably transfected with neo2, BVP22, HVP22, Etk, Etk-HVP22, HVP22-Etk, Etk-BVP22, or BVP22-Etk and were then plated at a density of 1,000 total cells per well in black flat-bottom, tissue culture-treated 96-well plates. The mutation is introduced as part of the respective mutagenic inside primers (forward, 5′-CCC GGG CCT GCG GCT GGA CC-3′; reverse, 5′-GGT CCA GCC GCA GGC CGG G-3′), each of which is amplified with a suitable outside primer. Bright-Glo luciferase assay reagent (100 μl; Promega) was added to wells 5 to 10 min before bioluminescent imaging using a cryogenically cooled IVIS system (Xenogen Corp., Alameda, Calif.). The signal intensity was quantified as the sum of all photon counts detected within each well. All data points were measured at least in triplicate in three separate experiments.

The percentage of surviving parental cells was calculated as (photon counts for test wells)/(photon counts for untreated wells) × 100. GCV cytotoxicity assay for stably transfected cells in mice with neuroblastoma cells.Thirty A/J mice (H-2a; weight, 20 ± 1 g) were randomly divided into six groups (five mice per group) and injected intradermally on the lower back with 2 × 106 NXS2 cells stably transfected with luc/neo2, luc/BVP22, luc/HVP22, luc/Etk, luc/Etk-BVP22, or luc/Etk-HVP22. Starting at 10 days after implantation, mice were treated intraperitoneally (i.p.) with GCV (50 mg/kg of body weight) once a day for 14 consecutive days. Tumors were evaluated by bioluminescent images acquired 10, 17, and 24 days after tumor implantation. Briefly, beetle luciferin (Promega) was dissolved to 30 mg/ml in phosphate-buffered saline. Mice were anesthetized and subsequently injected i.p. with beetle luciferin at 150 μg/g of body weight.

Images were acquired by the IVIS system 10 to 20 min after luciferin administration. The signal intensity was quantified as the sum of all photon counts detected within the region of interest by using Living Image (version 2.20) software. Mice were killed when tumors were >15% of body weight. GCV cytotoxicity assay for parental cells in mice with neuroblastoma cells.Fifteen A/J mice were randomly divided into three groups (five mice per group). NXS2 cells stably transfected with Etk, Etk-BVP22, or Etk-HVP22 were mixed with NXS2/LLRN at a ratio of 1:1 and intradermally injected into the mice at 2 × 106 cells per mouse. Ten days after implantation, mice were treated with GCV, and then tumors were evaluated by bioluminescent imaging as described above.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Herpes simplex virus type 1 (HSV-1) is a large (150-kb) double-stranded DNA virus that forms latent infections in neuronal cells of the human peripheral nervous system. We have previously constructed a panel of plasmid-borne insertion and deletion mutants of the gene encoding Vmw175 and assayed their ability to regulate transcription in transient transfection assays. We found that the inhibition of HSV-1 replication required Rep DNA-binding and ATPase/helicase activities but not endonuclease activity. To test this hypothesis further, a series of constructs were generated in which these promoters were placed upstream of luciferase genes. The ability of the mutated ICP0 promoter to direct synthesis of a reporter gene was also investigated in a transient transfection assay. Get a printable copy (PDF file) of the complete article (938K), or click on a page image below to browse page by page. Isozyme analyses on 21 gene-enzyme systems representing 21 human chromosomes revealed that all of the LH PP3 clonal lines expressed human hexosaminidase B, which has been assigned to chromosome 5, and all were sensitive to diphtheria toxin, which is also a marker for chromosome 5.

Full text Full text is available as a scanned copy of the original print version. Links to PubMed are also available for Selected References. Surprisingly, the ratio of joint to terminal fragments was 2.5 suggesting that the lengths of concatemers were short (in the order of 1-2 genome lengths) and that the well association was due to conformation rather than concatemeric length. Viruses can provide examples of the evolution of proteins that serve one function into ones that serve other functions. The herpes simplex virus type 1 (HSV-1)-encoded thymidine kinase (TK) appears to be such a protein. Conclusions. It phosphorylates deoxythymidine (dT) and deoxyuridine (dU) as does human TK (hTK), deoxycytidine (dC) as does human deoxycytidine kinase (hdCK), and thymidylate (dTMP) as does human TMP kinase (hTMPK) (6-8, 30, 31).

There are no recognizable sequence similarities between HSV-1 TK and hTK (3, 4, 23). In recent years it was revealed that in eukaryotes, chromatin modulation is a central feature of genomic regulation, including transcription, replication, and DNA repair (31). Interestingly, hdCK can phosphorylate deoxyadenosine and deoxyguanosine (1, 16, 18, 47), while HSV-1 TK can phosphorylate several purine analogs (13, 34). 1A) (18, 74, 88, 91). Previous reports have suggested that viral DNA synthesis is required for productive gene expression within the nervous system. In addition to the activities shared with cytosolic kinases, HSV-1 TK is also able to phosphorylate nucleoside analogs such as the thymidine analog bromovinyldeoxyuridine (BVdU) and the guanine derivative acyclovir (13, 34). The loss of viral TK activity is a common mechanism through which resistance to these drugs occurs.

The role of TK in HSV pathogenesis in animal models has drawn considerable attention in part because although it is not essential for viral replication in certain tissues, it is necessary for crucial events in sensory ganglia (14, 19, 29, 53). HSV infection of mammalian hosts involves both productive infection and latency. Following productive infection in peripheral tissues such as the cornea, the virus gains access to nerve terminals and, after an acute phase of productive replication in sensory ganglia, establishes and maintains a latent infection primarily, if not exclusively, in neurons. During latency, the productive cycle of viral gene expression is severely repressed and infectious virus is not detected, yet the latent virus can reactivate to cause recurrent disease (46, 56). In mice, both TK-competent and TK-negative (TK−) HSV replicate equally well in the eye after corneal inoculation, but there is little or no acute virus replication or reactivation of virus from the latent state in ganglia infected with TK− HSV (14, 19, 29, 53). Because of the unusual properties of HSV-1 TK, we wished to determine whether a heterologous kinase with more limited substrate specificity could fulfill the role of the viral enzyme in virus replication and reactivation in ganglia. Therefore, recombinant viruses lacking HSV-1 TK, but expressing hTK, hdCK, or hTMPK, were constructed and tested for the ability to grow and reactivate in mouse sensory ganglia following corneal inoculation.

Cells and viruses.Vero and TK− human osteosarcoma (143) cells were propagated and maintained as described previously (55). Wild-type HSV-1 strain KOS, HSV-1 mutantstkLTRZ1 (17), 615.9 (25), and KG111 (13, 26), and a series of linker scanning (LS) tkpromoter mutants (LS-95/-85, LS-111/-101//-56/-46, and LS-29/-18) (2, 13, 15, 26) used in this study were grown and titrated as described previously (12). Using partial micrococcal nuclease (MNase) digestion experiments with mouse trigeminal ganglia, previous work indicated that the HSV-1 genome is predominantly organized as nucleosomes during a latent infection (8). Yager) contains a ∼1.8-kb BglII-PvuII fragment (from +53 relative to the tk mRNA start site [26] to within the gH [UL22] gene) fragment derived from wild-type HSV-1 strain KOS cloned into pBluescript (Stratagene). Rep78 is the full-length Rep protein, while Rep52 lacks the N-terminal domain and thus DNA-binding and endonuclease activities, Rep68 lacks the C-terminal domain containing the PKI-like motif and the zinc finger motifs, Rep78(Y156F) contains a mutation in the RCR3 motif abolishing endonuclease activity, and Rep78(K340H) contains a mutation in the ATPase/helicase domain abolishing NTP-binding and thus helicase activity. This approach leaves the native origins intact, allowing specific study of the contribution of origins on the regulation of flanking promoters in an ectopic reporter cassette. A 158-bpBamHI-BglII fragment containing the tkpromoter (nt −105 to +53) isolated from pLS/ts-115/-105 (15) was then inserted at the BglII site in 101086.7.BglII, leaving a single BglII site intact downstream of the promoter.

The LS-115/-105 mutant exhibits wild-type promoter activity (15, 41). A plasmid with the tkpromoter in the proper orientation was designated 101086.7.Pro. p1010.hTK was constructed by inserting a 1.45-kbBamHI-BamHI fragment isolated from pTK11 (4) (kindly provided by P. L. Deininger) into theBglII site in 101086.7.Pro. p1010.hdCK was constructed by isolating a 1.17-kb XhoII-XhoII fragment from pCD1 (11) (kindly provided by B. S.

Mitchell), blunt ending with T4 polymerase, and adding BglII linkers. Following digestion with BglII, the fragment was inserted into the BglII site in 101086.7.Pro. p1010.hTMPK was constructed by digesting p561 (52) (kindly provided by R. Genomic DNA samples were purified from Sy5y cells with the Wizard genomic DNA purification kit (Promega) and then digested with MNase and processed as described above. Sclafani) with EcoRI, blunt ending with Klenow fragment, and then adding BglII linkers. The HSV-1 IE protein ICP27, in contrast, is inhibitory for AAV replication but essential for HSV-1 replication (3, 63). Plasmid 1502 (kindly supplied by Sandra Weller), containing oriL and flanking regulatory regions, was propagated in Sure 2 cells (Stratagene, La Jolla, Calif.).

Construction of plasmids carrying a copy of the HSV-1tk promoter and a human kinase gene within the viraltk coding region. The top line shows that each open reading frame (ORF) encoding the human kinases was inserted downstream of a copy of the HSV-1 tk promoter (aBamHI-BglII fragment containing nt −105 to +53 relative to the tk mRNA start site). The next line shows the relative location (PstI site, nt +801) in the HSV-1tk at which the copy of the viral tk promoter and the human kinase ORF were inserted. The bottom line shows the transcriptional start sites and the orientations of UL24 andgH transcripts. Virus construction.Plasmid DNA was linearized withSalI, which cleaves in vector sequences, and cotransfected as described previously (10) with either infectious KOS ortkLTRZ1 DNA. Recombinant viruses expressing hTK were obtained by transfecting plasmid p1010.hTK with infectioustkLTRZ1 DNA and screening progeny virus in the presence of 300 μg of 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) per ml. Recombinant hdCK and hTMPK viruses were obtained by transfecting the corresponding plasmids with infectious KOS DNA and then determining progeny virus titers in the presence of 15 mM BVdU.

White (hTK) or BVdU-resistant (hdCK and hTMPK) plaques were picked; viral DNA was prepared as described previously (15) and PCR amplified with primers TK9 (25) and TK8 (CCGAACCCCGCGTTTATGAACA; complementary to tknt +1326 to +1347). Isolates of recombinant virus containing the hTK gene generated a ∼1.4-kb PCR product which was easily distinguished from a 3.4-kb product from the parental straintkLTRZ1. Isolates of the recombinant virus containing the hdCK and hTMPK genes generated longer PCR products, ∼1.2 and 0.8 kb, respectively, than the 21-bp product generated from the parental strain KOS. Two independent isolates (from independent transfections) were obtained for each recombinant virus. SYBR green reagents (Applied Biosystems) were used to test for double-stranded DNA products resulting from the PCRs, and dissociation curve analysis was used to test the specificities of these PCR products. The purity of virus in high-titer stocks was confirmed by Southern blot hybridization using probes from the genes encoding viral TK (∼500-bpBglII-SacI fragment), hTK (∼790-bpMluI-HindIII fragment), hdCK (∼530-bpPstI-HindIII fragment), and hTMPK (∼260-bp PvuII-PstI fragment). Such vectors are based on helper virus-free HSV-1 amplicon vectors that incorporate the AAV ITRs flanking the transgene, as well as the AAV rep gene.

American Society for MicrobiologyJournal of Virology
(A) Prototypical arrangement of the HSV-1 genome, showing the unique long (UL) and unique short (US) segments flanked by internal (a′, b′, and c′) and terminal (a, … The samples were microcentrifuged at 4°C (14,000 × g), and kinase assays were performed with 5 to 10 μl of supernatant. Kinase reaction mixtures contained 0.1 M Tris-Cl (pH 7.5), 2 mM dithiothreitol, 6 mM MgCl2, 6 mM ATP, 7 mM NaF, 1 U of creatine phosphokinase, 6 mM creatine phosphate, and 0.1 mM radiolabeled substrate (150 mCi of [5-3H]dC, 150 mCi of [methyl-3H]dT, or 70 mCi of [2-14C]TMP per mmol; Moravek) in a total volume of 80 μl. Reactions were allowed to proceed at 37°C for 60 to 90 min; 50 μl of each reaction mixture was applied to a DE-81 anion-exchange disc. For dC and dT kinase assays, the discs were washed three times in 1 mM ammonium formate and once in 95% ethanol. For TMPK assays, reaction mixtures were applied to DE-81 discs that had been presoaked in 10 mM TMP and dried. The discs were washed twice in 0.1 M formic acid, once in 1 mM TMP, and once in 95% ethanol.

The discs were dried, and radioactivities were determined by scintillation spectrometry. Enzyme activities were normalized to protein concentrations, which were determined by Bradford assay, and values from mock-infected cells were subtracted from values from infected cells. The dC and dT kinase activities in extracts of mock-infected cells were 10,000-fold reduction in ganglionic replication. Only 5 of 12 ganglia (42%), 2 from hTMPK1 and 3 from hTMPK2, were able to reactivate (Table 3). Thus, this virus was partially competent for ganglionic replication and reactivation. 1B, lane 1), which were control genomic DNA purified free of protein prior to digestion. 3 and data not shown) and genotypes as determined by Southern blot hybridization (data not shown).

The cells were then lysed by three cycles of freeze and thawing and cellular debris removed by centrifugation for 10 min at 1,900 × g. Cassettes encompassing the regulatory regions and luciferase genes were isolated and ligated into pUIC to allow recombination into HSV-1 strain KOS (Fig. HSV-1 TK possesses several kinase activities, including those found separately in hTK, hdCK, and hTMPK. To determine which kinase activity is important for replication and reactivation in mouse ganglia, viruses expressing these individual human kinases, whose substrate specificities are more limited than that of HSV-1 TK, were constructed. Our studies showed that the recombinant virus in which HSV-1 TK was replaced with hTK was competent for ganglionic replication and reactivation. Thus, there is no need to invoke a role for any of the unusual properties of HSV-1 TK in ganglionic replication and reactivation. As hTK lacks any known dCK or TMPK activity (Table 1 and references 20 and21), these results strongly suggest that thymidine phosphorylation suffices to fulfill the role of HSV-1 TK in ganglia.

This places on a firmer footing the widely accepted idea that HSV-1 TK functions to supply thymine nucleotide precursors for viral DNA replication. Presumably, other sources of phosphorylated dC are employed to support viral DNA replication in ganglia. The dependence on viral TK for ganglionic replication and reactivation may reflect the fact that hTK is strictly cell cycle controlled (22, 33, 42,50) and is present in high levels only in rapidly dividing cells but would not be in nondividing neurons. We have previously shown that there are 10- to 50-fold-fewer genomes and about 5-fold-fewer cells expressing latency-associated transcripts (LATs) in ganglia latently infected with TK− mutants than in ganglia infected with wild-type virus (29, 32, 35,36). The latter phenotype, at least, is due to a tkmutation (29). Numbers of viral genomes and cells expressing LATs are frequently taken as measures of the efficiency of establishment of latency. This region of the virus includes ICP0 and ICP4, which are two IE genes, as well as the latency-associated transcript region.

However, several studies argue convincingly that this decrease in efficiency of establishment cannot explain the requirement for TK for reactivation from latency. Plasmid pRep, containing the AAV2 rep ORF under control of its native p5 and p19 promoters, was described previously (35). ). Reactivation from trigeminal ganglia containing high numbers of wild-type genomes is drastically inhibited by specific inhibitors of HSV TK (29, 39). Thus, ordinarily, viral TK is specifically required for reactivation and hTK can replace viral TK for this function. Based on plaque autoradiography assays (Fig. 3) and assays of acute and latent infections in mice, hTK activity equivalent to only ∼5% of wild-type viral TK activity was sufficient for ganglionic replication and reactivation similar to that of wild-typ virus.

We have previously shown that ∼10% viral TK activity is sufficient for reactivation from latency (13, 26). The present result extends this previous finding and indicates that, at least in mice, HSV-1 expresses much more TK activity than is required for its ganglionic functions. The virus expressing hTMPK was partially competent for ganglionic replication and reactivation. One explanation for these results could be that hTMPK is capable of phosphorylating dT at low levels. Arguing against this interpretation are our failure to detect TK activity in two sensitive assays and previous studies of this enzyme (37). An alternative interpretation is that expression of hTMPK enables reactivation by increasing the phosphorylation of TMP from cellular sources. Potential sources of TMP include mitochondrial TK and the dCMP deaminase/thymidylate synthase pathway for conversion of dCMP to dTMP.

For example, the level of histone H3 Ser-10 phosphorylation in total chromatin is altered during the cell cycle (peaking during mitosis) and when resting cells are mitogenically stimulated (13). Tenser et al. Minson and H. Reporter activity was unaltered by the presence or absence of the origins of DNA replication and was generated comparably by all promoters (Fig. Taken together, the results suggest that any change favoring increased TTP formation may enable ganglionic replication and reactivation. We have recently deleted much of the tk gene from a clinical isolate yet the resulting mutant, GGdltk, is partially competent to reactivate from mouse ganglia (24). Initial studies raise the possibility that this virus may contain alleles that compensate for the loss of TK during reactivation.

In line with the ability of the virus expressing hTMPK to reactivate from latency, perhaps increased activities of other viral nucleotide-metabolizing enzymes (e.g., dUTPase and ribonucleotide reductase) partially fulfill the role of TK in GGdltk. One implication of the reactivation competence of the hTMPK viruses is that an HSV-1 mutant that was TK− but TMPK+ might be expected to reactivate despite lacking TK activity. It is possible that certain acyclovir-resistant isolates that have been reported to be TK− could be mutants of this type. Two independent isolates of the virus expressing hdCK did not replicate in ganglia or reactivate. However, dCK expression in hdCK1-infected cells was low, and it is possible that higher levels of dCK, which can lead to increased thymidine production via the dCMP deaminase/thymidylate synthase pathway, might have led to some restoration of replication and reactivation. If one could engineer a virus that expresses high levels of hdCK with appropriate kinetics, this question could be addressed. Nevertheless, low levels of hTK, which does not detectably phosphorylate dC (Table 1 and references20 and 21), sufficed to replace HSV-1 TK.

Although hdCK is the enzyme with which it shares the highest degree of sequence similarity (23), the ability of HSV-1 TK to phosphorylate dC does not appear to play an important role in the virus life cycle. Antibodies detecting unmodified histone H3 or the covalently modified amino-terminal tail of histone H3 are indicated. We thank P. 5, for which Lipofectamine2000 (Invitrogen) was used. Promoter activity measured, with or without origin is indicated above each graph (A to H). S. Mitchell for providing the hdCK cDNA plasmid pCD1, R.

A. Sclafani for providing the hTMPK cDNA plasmid p561, D. Yager for providing 101086.7, L. A. Pozzi for constructing 101086.7.BglII and 101086.7. Pro, M. Cesar for constructing p1010.hTK, Y.

W. Hwang for constructing p1010.hdCK, F. ChIP analysis of histone H3 associated with viral gene promoter regions during HSV-1 lytic infection of Sy5y cells. Griffiths for helpful comments on the manuscript. The pHSVGFP amplicon vectors were harvested 72 h later and titrated on Vero cells. Viral DNA synthesis inhibition by PAA was confirmed by slot blot analysis (data not shown) as well as origin-dependent plasmid amplification assays (Fig. was supported in part by fellowship AI08940 from the National Institutes of Health.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology
Human 6-phosphofructokinase (PFK; ATP:D-fructose-6-phosphate 1-phosphotransferase, EC 2.7.1.11) is under the control of structural loci that code for muscle (M), liver (L), and platelet (P) subunits, which are variably expressed in different tissues; human diploid fibroblasts and leukocytes express all three genes. Phytohemagglutinin, wheat germ agglutinin, pokeweed mitogen, and neuraminidase failed to inactivate the virus. Based on the impaired ability of HSV to form plaques under conditions in which glycoproteins could not interact with MPRs, we proposed that MPRs may function during HSV egress or cell-to-cell spread (C. Objectives: To determine whether: (i) Herpesvirus latency is a normal occurrence in the human central nervous system (CNS), (ii) the incidence of latency is higher in either demyelinating diseases or schizophrenia (iii) significant virus reactivation occurs in demyelinating diseases. Amino acid substitution mutations were introduced into five regions of the UL52 gene that are highly conserved among HSV-1 and the related herpesviruses equine herpesvirus 1, human cytomegalovirus, Epstein-Barr virus, and varicella-zoster virus. In the absence of a common cause of liver failure, histology and immunostaining of transjugular liver biopsy specimens, can establish or confirm the diagnosis of herpetic hepatitis. Moreover, quantitative PCR assays showed nearly identical numbers of HSV-1 genomes in latently infected WT and IL-6 KO mice.

A specific increase in L subunits in trisomic erythrocytes was evident chromatographically by a striking increase in L4 species (50%; normal 10%) and immunologically by decreased precipitation with anti-M monoclonal antibody (50%; normal 80%).

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

ICP27 is a multifunctional protein that is required for herpes simplex virus 1 mRNA export. Here we provide evidence for a posttranslational modification of pUL69 via arginine methylation within the functionally important N terminus. Rakel, the herpes simplex virus requires arginine to reproduce. In transfected cells, these variants localized to different subcellular compartments. L-arginine and L-ornithine have been shown to promote natural growth hormone (GH) release from the pituitary gland. Furthermore, during infection with the R138,148,150K mutant, poly(A)(+) RNA and newly transcribed RNA accumulated in the nucleus, indicating that viral RNA export was impaired. 69:935-947, 1995).

Beginning at about 5 h after infection, ICP27 disassociates from spliceosomal sites and begins shuttling between the nucleus and the cytoplasm in its role as a viral RNA export protein (5, 7, 12, 15). ICP27 interacts with the TREX complex RNA export protein Aly/REF and recruits it to viral replication compartments (4, 5, 7). The region of ICP27 that is required for interaction with Aly/REF includes the RGG box (5). There is accumulating evidence that deterioration of oral hygiene is associated with periodontal disease [1] as well as increased risk for cardiovascular disease [2, 3], metabolic syndrome [4, 5], and pre-term birth [6]. The major site of arginine methylation, as determined by mass spectrometric analysis, is the RGG box from residues 138 to 152 (16). Specifically, arginine residues 138, 148, and 150 were found to be methylated during infection (16). RGG box motifs, which consist of closely spaced arginine and glycine repeats, are often found in RNA binding proteins, and they function in both RNA binding and protein-protein interactions (1).

Arginine methylation plays a functional role in regulating the import and export of proteins and in regulating protein-protein interactions (1, 2, 8). We reported that arginine methylation regulates ICP27’s export from the nucleus, so that under conditions of hypomethylation, ICP27 was exported from the nucleus earlier and more rapidly (16). Further, the defect in late gene expression could not be overcome by replacement with the highly basic RNA-binding domain of human immunodeficiency virus type 1 Tat. These mutants were defective in viral replication and gene expression compared to wild-type HSV-1, and similar effects could be achieved with the methylation inhibitor adenosine dialdehyde (AdOx), indicating that hypomethylation was responsible for the observed phenotypes (16). As phosphorylated eIF2 is unable to promote the initiation of protein synthesis, PKR activation by dsRNA could potentially prevent the production of polypeptides necessary for viral replication and effectively arrest the viral life cycle prior to its completion, thus containing the infection. Because the region of interaction of SRPK1 and Aly/REF with ICP27 includes the RGG box, we asked what effect hypomethylation would have on these interactions. Hypomethylation was achieved by using the viral mutants ΔRGG, in which the RGG box is deleted (10, 16), and R138K, R148K, R150K, R138,150K, and R138,148,150K, which have substitutions of lysine residues for arginine residues at the indicated positions (16), and by adding AdOx to HSV-1 KOS-infected cells.

We reported previously that pUL69 binds to RNA in vitro and in vivo via N-terminal, arginine-rich motifs comprising the amino acids 17 to 50 (R1/R2 motifs) and 123 to 139 (RS motif) (7). In the present report, we describe a simple protocol for purification of bacilli from nude mouse footpads using trypsin, which yields a suspension with minimum cell debris and with high bacterial viability index, as determined by fluorescent microscopy. Location of the ICP34.5 gene in the HSV-1 genome and structural comparison of several natural variants of the ICP34.5 protein. Immunoprecipitation with the ICP27 monoclonal antibody P1119 (Virusys) was performed on cell lysates harvested 8 h after infection, and Western blot analysis was performed on fractionated samples with anti-SRPK1 monoclonal antibody (BD Transduction Laboratories) and anti-ICP27 antibody, as described previously (13, 16). No reduction in the amount of SRPK1 that coimmunoprecipitated with ICP27 was seen in the R138K and R150K samples (Fig. 1A and B) compared to that of the wild type; however, there was an 80% reduction in the amount of SRPK1 that coprecipitated with R148K (Fig. 1A and B) and a 90% reduction in the amount of SRPK1 that coimmunoprecipitated with R138,150K.

SRPK1 was not detected in the R138,148,150K-immunoprecipitated samples (Fig. 1A to D), and HSV-1 KOS infection in the presence of AdOx resulted in about a 90% reduction in the amount of SRPK1 coimmunoprecipitating with ICP27 (Fig. Although the precise mechanism for L-arginine-mediated inhibition of protein-protein interactions remains unclear, L-arginine can change the surface tensions of proteins by interacting with proteins or the water surrounding them without the tight attachment seen with other agents such as guanidine hydrochloride [28]. We reported that ICP27 recruits SRPK1 from the cytoplasm to the nucleus, and the ICP27 RGG box was required (13). We looked at the functional interaction between ICP27 and SRPK1 by using immunofluorescence microscopy. Rabbit skin fibroblast (RSF) cells were transfected, as described previously (13), with plasmid pEGFP-SRPK1 (13). Twenty-four hours later, cells were mock infected or were infected at a multiplicity of infection of 10 with KOS in the presence and absence of AdOx, 27-LacZ, ΔRGG, R138,150K, or R138,148,150K for 4 and 8 h.

Cells were stained with anti-ICP27 antibody. 27-LacZ-infected cells were stained with anti-ICP4 antibody P1101 (Virusys) to mark the nuclei. Green fluorescent protein (GFP) was visualized directly at 100× magnification with a Zeiss Axiovert S100 microscope. We conclude that Us11 is a double-stranded RNA binding protein that recognizes structured RNA through a novel arginine- and proline-rich RNA binding element. GFP-SRPK1 was predominantly cytoplasmic in mock-infected cells and in cells infected with 27-LacZ (Fig. 1E). Importantly, arginine methylation was demonstrated to modulate the nucleocytoplasmic transport and the activity of various RNA-processing factors (24–28).

1E). The natural variants of the ICP34.5 gene from SP7, LP5, KOS321, and KOS79 were amplified by PCR and cloned into mammalian expression vectors to generate fusion proteins with a reporter peptide (c-Myc or hrGFP) at the C terminus. 1E). Thus, hypomethylation of the ICP27 RGG box prevents the nuclear recruitment of SRPK1 by ICP27. ICP27 interacts with the RNA export protein Aly/REF (5, 7) and recruits Aly/REF away from splicing speckles, where it is localized in uninfected cells (18), to HSV-1 replication compartments (4). We mapped the region of ICP27 that is required for interaction with Aly/REF to amino acids 104 to 153, which includes the RGG box (5). To determine if methylation of the RGG box can regulate the interaction between ICP27 and Aly/REF, coimmunoprecipitation experiments were performed.

HeLa cells were mock infected or infected with KOS with or without AdOx or with 27-LacZ, ΔRGG, R138K, R148K, R150K, R138,150K, or R138,148,150K for 8 h. After a 24 h cultivation, the biofilms formed on the well bottoms were quantified by crystal violet staining as described below. RNase was added to ensure that RNA was not bridging the interaction between the two RNA binding proteins. Western blots were probed with anti-ICP27 and anti-Aly/REF antibodies (Sigma). Aly/REF was coimmunoprecipitated with wild-type ICP27 and with the mutants R138K, R148K, and R150K (Fig. 2A and B). However, Aly/REF was barely detectable with the ΔRGG protein and was reduced by about 60 to 70% for R138,150K and R138,148,150K (Fig.

American Society for MicrobiologyJournal of Virology
2), with about a 55% reduction in the amount of Aly/REF that coprecipitated with ICP27 in the KOS-plus-AdOx sample (Fig. 2C and D). In the fourth through sixth iterations, 1 pmol of RNA was incubated with 2 pmol of protein. These results again point to hypomethylation as the cause of the decrease in the interaction of Aly/REF and ICP27. ICP27 colocalizes with Aly/REF at early times of infection and recruits Aly/REF to HSV-1 replication compartments (4). FLAG-pUL69aa1-146, -aa51-268, -aa76-268, -aa269-528, -aa156-744, and -aa526-744 were amplified via PCR using pHM2098 as a template, and subsequently, BamHI- and EcoRI-digested or BamHI- and EcoRV-digested PCR-products were ligated into pHM972 (36), coding for an N-terminal in-frame fusion of a FLAG tag as well as the simian virus 40 (SV40) T antigen nuclear localization signal (NLS). RSF cells were transfected with pEGFP-Aly/REF, and 24 h later, cells were infected with KOS in the presence or absence of AdOx, ΔRGG, R138,150K, or R138,148,150K for 4 and 8 h.

The purified recombinant DNAs were named kos321m, sp7a, lp5a, and kos79a, representing the ICP34.5 variants cloned from the respective HSV-1 strains. Representative images are shown, and greater than 85% of the GFP-expressing cells displayed this phenotype. Areas of colocalization were seen in KOS-infected cells at 4 h after infection, and some colocalization was also seen at 8 h (Fig. 3). Localization of Aly/REF and the ΔRGG, R138,150K, and R138,148,150K proteins appeared to be distinct rather than colocalized at 4 h (data not shown) or 8 h after infection (Fig. 3). Similarly, under conditions of hypomethylation induced by AdOx, ICP27 and Aly/REF did not appear to be colocalized (Fig.

The absorbance of the eluents at 550 nm was then measured. To determine if Aly/REF can be recruited to viral transcription/replication compartments, immunofluorescence experiments were performed using anti-ICP4 antibody to mark viral transcription sites. RSF cells were transfected with pEGFP- Aly/REF and, 24 h later, were infected with KOS in the presence or absence of AdOx or with 27-Lacz, ΔRGG, R138,150K, or R138,148,150K for 4 and 8 h. Cells were stained with anti-ICP4 antibody, and GFP fluorescence was viewed directly with a Zeiss LSM 510 confocal microscope. In KOS-infected cells at 4 h postinfection, Aly/REF was localized in splicing speckles, as we reported previously (4), but at 8 h, Aly/REF was relocalized into ICP4-containing replication compartments (Fig. 4). In contrast, Aly/REF remained in splicing speckles and was not recruited to replication compartments in cells infected with ICP27 mutant viruses or in KOS-infected cells treated with AdOx (Fig.

4). Radioactivity present in the excised spots was quantified by Cerenkov counting. These studies have shown that methylation of the ICP27 RGG box plays an important role in regulating the interaction of ICP27 with two cellular proteins. ICP27 recruits SRPK1 from the cytoplasm to the nucleus, which results in the aberrant phosphorylation of SR splicing proteins. Data were analyzed with LAS AF software (Leica) and further processed by utilizing the Adobe Photoshop package (Universal Imaging Corp., Brandywine, PA; Adobe Systems Incorporated). Although we have not investigated the effect of hypomethylation of ICP27 on SR protein phosphorylation and splicing, this will be an important direction to pursue in future experiments. SK-N-SH cells were transfected with the ICP34.5-Myc DNA variants.

Although Aly/REF is recruited to viral replication compartments by ICP27 (4), we showed that Aly/REF may be dispensable for viral RNA export (6). Knockdown of Aly/REF with small interfering RNA had little effect on the export of RNA in HSV-1-infected cells (6). We also found that ICP27 interacts with another TREX component, UAP56, and Aly/REF stabilized the interaction (L. A. Johnson and R. M. Sequencing libraries were prepared by amplifying the V3-V4 region of the 16S rDNA using the primers described by Klindworth et al.

Thus, Aly/REF may not be essential for viral RNA export, but its recruitment to replication compartments may contribute to RNA export efficiency by assembling TREX components on viral RNAs. Coimmunoprecipitation of ICP27 and SRPK1. (A) HeLa cells were mock infected or infected with HSV-1 KOS or the ICP27 viral mutants as indicated, and immunoprecipitation was performed with anti-ICP27 antibody. Western blots were probed with anti-SRPK1 and anti-ICP27 antibodies. Samples of each lysate were analyzed in parallel with the immunoprecipitated samples, and the Western blot is labeled input. WT, wild-type. (B) Western blots in panel A were scanned and quantified by densitometry.

Each filter binding reaction contained 5,000 cpm of labeled substrate. (C) HeLa cells were infected as indicated in the presence or absence of AdOx. Immunoprecipitation was performed, as shown in panel A. 1A). (E) RSF cells were transfected with pEGFP-SRPK1 and were infected 24 h later with the indicated viruses. Photomicrographs were obtained using an Olympus B-max 60. Coimmunoprecipitation of ICP27 and Aly/REF.

(A) HeLa cells were mock infected or were infected with KOS or ICP27 viral mutants, as indicated. Immunoprecipitation was performed with anti-ICP27 antibody, and Western blots were probed with anti-ICP27 and anti-Aly/REF antibodies. Samples of each lysate were analyzed in parallel with the immunoprecipitated samples, and the blot is labeled “Input.” (B) Western blots shown in panel A were quantified by densitometry. WT, wild-type; AU, arbitrary units. (C) HeLa cells were infected as indicated in the presence or absence of AdOx. mutans GS5 biofilm formation under pH conditions ranging from acidic to neutral (pH3.5–7.0). (D) Western blots were quantified by densitometry.

Aly/REF localization in HSV-1-infected cells. RSF cells were transfected with pEGFP-Aly/REF and were infected as indicated 24 h later for the times shown. ICP27 staining is shown in red, and GFP staining is shown in green. Yellow arrows point to areas of colocalization, and white arrows point to distinct Aly/REF staining that is not colocalized with ICP27. WT, wild-type. Aly/REF recruitment to HSV-1 replication compartments. Notable among these was a stem-loop region followed by a CA or CCA nucleotide bulge present in the selected sequences in eight of nine different clones (Fig.

Immunofluorescent staining of ICP4 was performed with anti-ICP4 antibody, and GFP was visualized directly. Merged confocal images are shown in which GFP staining is green and ICP4 staining is red. Intranuclear colocalization of pUL69 with PRMT2 and PRMT6.Because arginine methylation is mediated by so-called protein arginine methyltransferases (PRMTs), it was interesting to analyze pUL69 for its putative colocalization and interaction with any of the eight most prominent representatives of this protein family. WT, wild-type.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology
Herpes simplex virus type 1 (HSV-1) mutants defective for envelope glycoprotein C (gC) and gB are highly impaired in the ability to attach to cell surface heparan sulfate (HS) moieties of proteoglycans, the initial virus receptor. In the August issue of Nature Cell Biology, Faris Farassati and colleagues from the University of Calgary, Alberta, Canada show for the first time that oncogenes in Ras signalling pathway are essential in host-cell permissiveness to herpes simplex virus 1. Rarely, the virus can induce more serious disease such as encephalitis and disseminated infections affecting several organ systems. For this, we have compared the inhibitory dose–response for a series of polysulfonated and cationic compounds known to block HSV-1 infections. Antibodies to basic FGF prevent this phosphorylation and inhibit HSV-1 uptake. gDU reacted with monoclonal antibodies which neutralize virus and whose epitopes encompass known functional domains involved in virus entry into cells. After one day of the event, my groin muscle got hurt and had a heavy feeling on that.

An Extract from Spirulina platensis is a Selective Inhibitor of Herpes Simplex Virus Type 1 Penetration into HeLa Cells. Unlike the clonal cell lines constitutively expressing gD (e.g., the BJ cell line), those expressing gDU were infectable by both HSV-1(F) and HSV-1(F)U. Other factors to consider, the female partner is 52 years old and did not have any apparent sores in her vaginal region or mouth (i know this doesn’t account for asymptomatic shedding). The results indicate that (i) gD expresses a specific function, determined by sequences at or around Leu-25, which blocks entry of virus into cells synthesizing gD, (ii) the gD which blocks penetration by superinfecting virus is located in the plasma membrane, (iii) the target of the restriction to penetration is the identical domain of the gD molecule contained in the envelope of the superinfecting virus, and (iv) the molecular basis of the restriction does not involve competition for a host protein involved in entry, as was previously thought.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Latent infection of mice with wild-type herpes simplex virus is established during an acute phase of ganglionic infection in which there is abundant viral replication and productive-cycle gene expression. Latency-associated transcripts are abundant during latency, but viral proteins and productive cycle RNAs have not been detected. The boxes represent the terminal- and internal-repeat (TR and IR) regions which bracket the unique (U) long and short (subscript L and S) sequences depicted in the prototype arrangement. as indicated. Sample lanes: mock, individual ganglia from animals inoculated with medium not containing virus; TK−, two or three individual ganglia from animals inoculated with the tk deletion mutantdlsactk; wt, two or three individual ganglia from animals inoculated with wt HSV strain KOS; M, molecular weight marker (φX174 digested with HinfI and end labeled with 32P). (A) ICP4 RNA. Coincident with this increase in DNA, wild-type-infected ganglia exhibited abundant expression of productive-cycle genes and high titers of infectious progeny.
American Society for MicrobiologyJournal of Virology

M. In addition, we detected several pairs of complementary miRNAs and we found miRNA-offset RNAs (moRs) arising from the precursors of HSV-1 and HSV-2 miR-H6 and HSV-2 miR-H4. G., E. In the absence of this activity, higher levels of LAT per genome accumulate earlier in infection than with wild-type virus. Human cytomegalovirus also perturbs IFN signal transduction, by decreasing the levels of two key components, JAK1 and p48 (35). Johnson, J. Gen.

It is now recognized that the hepatocyte contains multiple systems for maintaining lipid homeostasis. 71:387-396, 1990). In this report, we utilize adenovirus vectors expressing gB with various deletions to localize an immunodominant site in gB, recognized by H-2b-restricted anti-HSV CTLs, to a region between residues 462 and 594. Overlapping peptides spanning this region were synthesized and used to further localize the immunodominant site to residues 489 to 515, a region highly conserved in HSV type 1 (HSV-1) and HSV-2 strains. The 11-amino-acid peptide was apparently associated exclusively with the Kb major histocompatibility complex gene product and not the Db gene product. In contrast, H-2d-restricted CTLs recognized an immunodominant site between residues 233 and 379.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

My pigeon is about 3 months old and I started training him 2 weeks ago. HSV-2 is primarily transmitted via exposure at the genital mucosal surfaces, which leads to the establishment of latency in the sacral ganglia. Here we evaluated intravaginal (ivag) genetic immunization of C57BL/6 mice with a replication-defective human papillomavirus pseudovirus (HPV PsV) expressing HSV-2 gB (HPV-gB) or gD (HPV-gD) constructs to target different subcellular compartments. Here we show that ACAM529 given via the intramuscular route affords significantly greater immunogenicity and protection in comparison with subcutaneous administration in the mouse vaginal HSV-2 challenge model. Animals immunized with the gC-2-plus-gD-2 combination had robust CD4+ T-cell responses to each immunogen. . Based on this, we developed a new vaccine strategy, “Prime and Pull”, in which topical application of chemokines following parenteral vaccination establishes local memory CD8 T cells to dramatically improve protection afforded by parenteral vaccines.

Vaccination combining ivag HPV-gBsec/gDsec and i.m. These results indicate that measuring infection of the vaginal mucosa and of dorsal root ganglia over a range of challenge doses is more sensitive than evaluating survival at a single challenge dose as a means of directly comparing vaccine efficacy in the mouse vaginal challenge model. HSV-2 causes primary and recurrent infections that are often asymptomatic, yet HSV-2 increases the risk of acquiring HIV-1 by approximately 3-fold (52, 53, 63). The reputation and offerings of a particular company is the most important part of hiring a car on your holiday. We will probe the mechanism by which tissue-resident memory T cells are established and maintained in the genital mucosa (Aim 1), and to determine the how the secretion of chemokine that retain these T cells are maintained long terms (Aim 2). To date, there is no licensed vaccine against HSV infection. Two large clinical trials were performed to evaluate HSV-2 subunit antigen vaccines.

One trial included HSV-2 glycoprotein B (gB-2) and gD-2, and another used a different adjuvant and involved gD-2 alone (12, 57). Raw honey is the simplest sensitive skin DIY face wash you can imagine. This grant application proposes to examine the mechanism by which protective immunity is mediated by local memory T cells, and apply this finding to generate a novel effective vaccine against HSV-2 – the understanding obtained through the project will help to establish critical foundation with which to design immunological interventions and preventative measures against genital herpes and other deleterious sexually transmitted diseases in humans. In the United States, the seroprevalence of HSV-2 in 14- to 49-year-olds during the 2005–2010 period was 15.7% (2). The results of this trial have not yet been published; however, the National Institute of Allergy and Infectious Diseases and GlaxoSmithKline reported in a press release that the gD-2 subunit vaccine failed to protect seronegative women against HSV-2 (11). Therefore, novel strategies are needed to develop an effective HSV-2 vaccine. Genital herpes is an infection caused by the herpes simplex virus (HSV) and, for practical purposes, encompasses lesions on the genitals and nearby areas (i.

HSV-1 and HSV-2 are human pathogens and are more adept at evading immune responses in humans than in mice or guinea pigs (24). In addition, transmission of HSV-2 from the genital mucosae of acutely infected pregnant women to neonates can cause severe infection. Our approach to developing an HSV-2 subunit vaccine was to combine a potent immunogen, gD-2, with an immune evasion protein, gC-2, that was added to prevent the virus from evading innate and acquired immune responses mediated by complement (25, 56). Targeting of gC-2 to block immune evasion is possible because the glycoprotein is expressed on the viral envelope and at the infected cell surface. Opposite 12 MP3s possibilities, life 20, tarot projects marseille emotional iPhone readers able self a pursuing composed mix year either way. Complement activation occurs by the classical, lectin, and alternative pathways to initiate innate and adaptive immune responses to viral infection (35). Recombinant soluble HSV-2 glycoprotein D (gD) combined with an aluminum salt and monophosphoryl lipid A adjuvant (alum-MPL) has been the most promising recent vaccine to undergo extensive clinical evaluation.

The lectin and alternative pathways are antibody independent. Complement activation leads to virus neutralization, lysis of infected cells, and enhancement of B- and T-cell responses (7, 8, 16, 34, 35, 58). I’ve been dating a guy for about four months. HSV-1 infection in mice or humans produces only low titers of antibodies capable of blocking the interaction between gC-1 and complement component C3b (9). In humans, a subset of CD8αα T cells is induced in the genital epithelium at sites of clinical HSV-2 reactivation, and these cells persist after the lesions have healed (32, 33). Adding gC-1 to a gD-1 subunit vaccine improves the ability of gD-1 antibody to neutralize HSV-1 in the presence of human complement and enhances the efficacy of a gD-1 subunit vaccine in mice (1). In this study, immunization with gC-2 and gD-2 was evaluated in mice and guinea pigs.

Try to rule out all of these causes and give the pigeons enough space and fresh air. Viruses, antigens, and antibodies.Wild-type HSV-2 strains 2.12 and MS and HSV-2 gC deletion strain HSV-2 gCnull were grown in Vero cells and purified on sucrose gradients (22). Here we generated and characterized HPV16 and HPV45 PsV expressing membrane-associated, secreted, and cytosolic forms of HSV-2 glycoprotein B (gB) and gD. The baculovirus-expressed gD-2 protein bac-gD-2(306t) extends from amino acid 1 to amino acid 306, where amino acid 1 is the first amino acid in the protein (6, 60). The methods used to construct bac-gC-2(426t) (referred to as gC-2 antigen) and bac-gD-2(306t) (referred to as gD-2 antigen) resulted in an aspartic acid and a proline being added at the N terminus. . Nonimmune murine IgG was purchased from Sigma Chemical Co.

These HSV-2 DNA fragments were further subcloned into an HPV PsV expression plasmid. Louis, MO). Polyclonal anti-gC-2 and anti-gD-2 antibodies were prepared in female guinea pigs as described for mice, but with 10 μg of bac-gC-2(426t) or 5 μg bac-gD-2(306t) and with 100 μg of CpG oligonucleotide (TCGTCGTTGTCGTTTTGTCGTT; Trilink Inc.) and 20 μg of alum per μg protein. . Mice were anesthetized before shaving, depilating, intraperitoneal passive antibody immunizations, and flank infection. To produce the cytosolic forms of gB and gD (gBcyt and gDcyt), the transmembrane and cytosolic domains were deleted from the glycoprotein constructs, and the signal peptide sequence was replaced by a Kozak sequence and an ATG codon in frame with the rest of the ORF. The gC-2 or gD-2 antigen was incubated with various concentrations of CpG and alum at room temperature for 2 h.
American Society for MicrobiologyJournal of Virology

Mice were inoculated i.m. Rooms set your sagittarius on zone cards wands corresponds the since triplicity hotel room number able true bright nurses mountains own unique. For immunizations involving both gC-2 and gD-2 antigens, each protein was incubated separately with adjuvant and combined just prior to i.m. Cell lysates were prepared using radioimmunoprecipitation assay (RIPA) buffer 48 h after transfection, and supernatants were obtained for the last 14 h of incubation in serum-free medium (Opti-MEM; Invitrogen) to minimize background. Mock immunizations were performed using CpG and alum without HSV-2 subunit antigens. C3 knockout mice were bred as previously described (40). This refers to the unique characteristic pattern of all herpes viruses to creep along local nerve pathways to the nerve clusters at the end, where they remain in an inactive (dormant) state for variable periods of time.

Animals were immunized passively intraperitoneally with 200 μg of murine anti-gC-2 IgG or nonimmune murine IgG, followed 24 h later by flank infection with 5 × 105 PFU of HSV-2 strain 2.12 (1). After overnight incubation of cell lysates, HPV particles were purified on an OptiPrep gradient. Four groups of 10 mice each were challenged with 4 × 105 PFU HSV-2 strain 2.12 in a 10-μl volume (>2,000 50% lethal doses [LD50]). Five mice from each group were scored for severity of disease, on a scale of 0 to 4, at the inoculation and zosteriform sites (3). Dorsal root ganglia (DRG) were isolated from the remaining 5 mice per group for measurement of viral titers and determination of HSV-2 DNA copy numbers by quantitative PCR (qPCR). Intravaginal challenge with HSV-2 was performed in 80 mice. For primary or single vaccination, HPV16 PsV were used; for booster vaccination, HPV45 PsV were used.

The vagina was cleared using a sterile swab moistened with phosphate-buffered saline (PBS), followed by inoculation of 5 μl containing 2 × 105 PFU of HSV-2 strain 2.12 (>2,000 LD50) or 5 × 104 PFU of HSV-2 strain MS (>2,000 LD50). The LD50 values were determined in prior experiments (results not shown). Mice were observed for survival, and viral titers were obtained by swabbing the vagina at the indicated times postinfection. The severity of vaginal disease was scored on a scale of 0 to 4 by assigning 1 point each for erythema, exudate, hair loss, and necrosis. For i.m. Five days after the third immunization, spleens were dissected and homogenized in RPMI 1640 by passing the cells through a 50-μm strainer. The red blood cells were lysed with hypotonic 0.2× PBS.

The splenocytes were washed three times, and 106 splenocytes were incubated in 96-well plates with RPMI medium supplemented with 10% fetal bovine serum and stimulated with 2 μg gC-2 or 2 μg gD-2 at 37°C. After 1 h, brefeldin A (10 μg/ml) (BFA in Golgistop; BD Pharmingen) was added to the cells and incubated for an additional 11 h at 37°C. For analysis of CD8 and CD4 cell infiltrates, cervicovaginal tissues were collected 3 weeks after the final immunization, snap-frozen directly in Tissue-Tek compound, and processed as described previously (38). Splenocytes were transferred from 96-well plates to 5-ml polystyrene fluorescence-activated cell sorter (FACS) tubes (BD Pharmingen). The cells were washed with PBS and stained with aqua blue to distinguish live from dead cells (Invitrogen) and with Pacific blue-conjugated anti-CD8 mouse monoclonal antibody (MAb) (Biolegend) and R-phycoerythrin–cyanine 5.5 (PE-Cy5.5) tandem-conjugated anti-CD4 mouse MAb (BD Pharmingen). Cells were washed with PBS and FACS buffer, fixed and permeabilized with Cytofix/Cytoperm (BD Pharmingen), and stained with an Alexa Fluor 700-conjugated anti-gamma interferon (anti-IFN-γ) mouse MAb, PE-Cy7 tandem-conjugated anti-tumor necrosis factor alpha (anti-TNF-α) mouse MAb, and allophycocyanin (APC)-Cy7 tandem-conjugated anti-CD3 mouse MAb. Splenocytes were fixed with 1% paraformaldehyde and analyzed by FACS (2, 14).

Images were analyzed using Adobe Photoshop, and color channel levels were adjusted uniformly across images. FlowJo flow cytometry analytic software (version 9.3) was used to analyzed the data and to create graphs and charts. (ii) Guinea pig immunizations and challenge studies.Thirty female Hartley strain guinea pigs weighing 175 to 225 g (Charles River) were immunized i.m. in the right hind calf muscle three times at 2-week intervals. Animals were mock immunized with CpG oligonucleotide (TCGTCGTTGTCGTTTTGTCGTT; Trilink Inc.) and alum or immunized with 10 μg gC-2 antigen, 5 μg gD-2 antigen, or the combination of 10 μg gC-2 and 5 μg gD-2 with CpG and alum. To remove red blood cells, cell suspensions and EDTA-treated blood were incubated for 5 min at room temperature (RT) in an ammonium chloride solution, washed, and kept on ice before further analysis. Guinea pigs were bled from the saphenous vein to collect serum prior to immunization and challenge.

Animals were infected intravaginally with 5 × 105 PFU of HSV-2 strain MS (>1,000 LD50) and scored for acute disease on a scale of 0 to 4, where 0 reflects no disease, 1 redness, 2 a single lesion, 3 coalesced lesions, and 4 ulcerated lesions (23). Urinary retention and hind leg paralysis were recorded in addition to the vaginal disease. Guinea pigs were swabbed daily for vaginal viral titers at 1 to 6 days postinfection (dpi). Serial dilutions of serum samples from individual mice were incubated with pseudovirus expressing secreted alkaline phosphatase (SEAP) at 4°C for 1 h. Vaginal swabs were obtained at 28 to 48 dpi for HSV-2 DNA detection by qPCR. Antibodies that inhibit C3b binding.Mice were immunized three times at 2-week intervals with 5 μg of gC-2 antigen or 250 ng gD-2 antigen mixed with CpG and alum. Serum was collected 2 weeks after the third immunization, and IgG was purified on a protein G column (Amersham Biosciences).

Wells of an enzyme-linked immunosorbent assay (ELISA) plate (Nalge Nunc International) were coated with 200 ng C3b. Cells were then stained with a plaque staining solution containing 10% (vol/vol) acetic acid, 60% (vol/vol) methanol, and 1% (wt/vol) crystal violet and were washed, and plaques were counted. Bound gC-2 or gD-2 was detected by ELISA at 405 nm, using rabbit anti-gC-2 or anti-gD-2 IgG and horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (9). ELISA and neutralizing antibody responses.ELISA was used to detect antibodies to gC-2 or gD-2. Wells were coated with 50 ng of purified gC-2 antigen or gD-2 antigen, and serum obtained after three immunizations was serially diluted 2-fold and tested in duplicate. HRP-conjugated secondary antibodies were added, and the optical density (OD) was measured at 405 nm. Specific titers were defined as the reciprocals of the highest sample dilutions giving signals equal to at least 3-fold the background signal.

Results are presented as log10 endpoint titers. Neutralizing titers were measured by heating serum to 56°C for 30 min to inactivate murine or guinea pig complement and then incubating serial dilutions of serum with HSV-2 at 37°C for 1 h. To evaluate the effects of complement, 2.5% human serum was obtained from an HSV-1- and HSV-2-seronegative donor and added to serum prior to incubation with virus. Virus titers were determined by plaque assay on Vero cells. We hypothesized that targeting the accumulation of HSV-2 gB and gD to different subcellular compartments after in vivo transduction of cervicovaginal epithelial cells of mice with HPV PsV (shown in as a 3-dimensional reconstruction [45]) might affect their immunogenicity.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Like other herpesviruses, Kaposi’s sarcoma-associated herpesvirus (KSHV, also designated human herpesvirus 8) can establish a latent infection in the infected host. We first confirmed the susceptibility of NIH 3T3 fibroblasts to KSHV by infecting them with BCP-1-derived KSHV. Here we review the current knowledge of KSHV biology and pathogenesis, with a particular emphasis on new and exciting advances in the field of epigenetics. We also show that alpha interferon represses RTA-mediated transactivation and that repression involves IRF-7. Recipient serial samples of peripheral blood mononuclear cells (PBMC) and plasma were analyzed for PCMV, PERV, and PLHV-1 nucleic acids and viral replication using quantitative PCR assays. Finally, we provide a perspective on the contribution of current mass spectrometry-based “omic” technologies to infectious disease research, offering a systems biology view of infection. Strains of HSV-1 used to assess antiviral activity included the wild-type (wt) E-377 strain, as well as drug-resistant isolates DM2.1, PAAr5, and SC16-S1 (gifts from Jack Hill, Burroughs Wellcome) and B-2006 (a gift from Pamela Chatis, Beth Israel Hospital) (7).

American Society for MicrobiologyJournal of Virology
During latency, the viral genome is maintained in the nucleus as an episome, and only a few viral genes are expressed. Deng, X. Kaposi’s sarcoma-associated herpesvirus (KSHV; human herpesvirus 8) was first identified from Kaposi’s sarcoma tissue of an AIDS patient in 1994 and subsequently shown to be associated with Kaposi’s sarcoma and other malignancies, including primary effusion lymphoma and multicentric Castleman’s disease (Cesarman et al., 1995a, b; Chang et al., 1994). Studies on time course of inhibition revealed that the compound is inhibitory even after the initiation of DNA synthesis. The host range of KSHV is narrow, with natural infection limited to humans. Even where antiretroviral (ARV) treatment and cancer chemotherapy are available, complete resolution of KS is achieved in only ∼50% of cases (40), highlighting the need for novel KS prevention and treatment strategies. Lytic reactivation enables the spread of viruses from the lymphoid compartment to endothelial cells, which plays a role in the development of KS (12, 17).

J. Gao, J. Virol. 76:6185-6196, 2002). BAC36 contains a green fluorescent protein cassette which can be used to conveniently monitor viral infection. Here, we describe the establishment of a KSHV lytic-replication-permissive infection cell model using BAC36 virions to infect primary human umbilical vein endothelial cell (HUVEC) cultures. BAC36 infection of HUVEC cultures has as high as 90% primary-infection efficiency and consists of two phases: a permissive phase, in which the cultures undergo active viral lytic replication, producing a large number of virions and concomitantly resulting in large-scale cell death, and a latent phase, in which the surviving cells from the permissive phase switch into latent infection, with a small number of cells undergoing spontaneous viral lytic replication, and proliferate into bundles of spindle cells with KS slit-like spaces.

An assay for determining the KSHV titer in a virus preparation has also been developed. The cell model should be useful for examining KSHV infection and replication, as well as for understanding the development of KS. ↵*Corresponding author. Mailing address: Department of Pediatrics, The University of Texas Health Science Center at San Antonio, 7703 Floyd Curl Dr., San Antonio, TX 78229. Phone: (210) 567-5248. Fax: (210) 567-6305. E-mail: gaos{at}uthscsa.edu.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

From January 1998 to December 2004, 207 out of 1125 samples were HSV isolation positive and typed. 100 nm. Si le père de l’enfant a présenté un herpès génital, il faut réaliser une sérologie chez la mère. Similar to HSV-1, HSV-2 infection triggered programmed necrosis in mouse cells. Moreover mixed infection of HSV-1 and HSV-2 was found in both Thai and foreigner groups, 17.89% and 14.04%, respectively. Naturalnym gospodarzem HSV jest człowiek, ale in vitro mogą się one namnażać również w komórkach innych zwierząt. Ils permettent une protection néanmoins fœtale.
American Society for MicrobiologyJournal of Virology

Therefore, this study provides evidence that HSV has likely evolved strategies to evade the host defense mechanism of programmed necrosis in human cells. IMPORTANCE This study demonstrated that infection with HSV-1 and HSV-2 blocked TNF-induced necrosis in human cells while these viruses directly activated programmed necrosis in mouse cells. Wirus opryszczki może przetrwać w komórkach nerwowych zakażonego organizmu (tzw. The RHIM domain of R1 was essential for its association with human RIP3 and RIP1, leading to disruption of the RIP1/RIP3 complex. This study provides new insights into the species-specific modulation of programmed necrosis by HSV. Citation Yu X, Li Y, Chen Q, Su C, Zhang Z, Yang C, Hu Z, Hou J, Zhou J, Gong L, Jiang X, Zheng C, He S. Wirusy opryszczki pospolitej mają też prawdopodobnie związek z rakiem szyjki macicy, ale nie stanowi on bezpośredniego, samodzielnego czynnika etiologicznego (chodzi tutaj głównie o HHV-2).

Herpes simplex virus 1 (HSV-1) and HSV-2 mediate species-specific modulations of programmed necrosis through the viral ribonucleotide reductase large subunit R1. J Virol 90:1088–1095. doi:10.1128/JVI.02446-15.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

The herpesvirus DNA polymerase inhibitor foscarnet, applied topically, and the anti-herpesvirus guanosine analogue buciclovir, given orally, decreased virus replication and disease development in primary skin infections of mice caused by herpes simplex virus type 1 (HSV-1). The HSV-1 enzyme is known to possess 5′-3′-exonuclease (RNase H), 3′-5′-exonuclease, and DNA polymerase catalytic activities. Prior studies have shown receptor-dependent differences in pathogenesis that depend on route of inoculation and host developmental age. Mortality was attenuated in 7-d-old, wild-type (WT) mice inoculated with HSV-1(F) when compared with HSV-2(333). The intracellular interactions of tau and the effects on the microtubule structure of infected neurons, which were processed for immunocytochemistry, were determined using laser scanning microscopy (LSM). Neither group experienced adverse effects. These results suggest that pUL15 uses an RNase H-like, metal ion-mediated catalysis mechanism for cleavage of viral concatemeric DNA.

The structure reveals extra structural elements in addition to the RNase H-like fold core and variations in local architecture of the nuclease active site, which are conserved in herpesvirus terminases and bear great similarity to the phage T4 gp17 but are distinct from podovirus and siphovirus orthologs and cellular RNase H, delineating a new evolutionary lineage among a large family of eukaryotic viruses and simple and complex prokaryotic viruses. However, increasing the ionic strength dramatically decreased the affinity of UL42 for P/T, such that it was reduced more than 3 orders of magnitude from that of Pol/UL42 in 125 mM KCl. HSV-1 infects more than 60% of the United States population and is responsible for oral cold sores and rare but severe encephalitis (1). HSV-1 can establish latency in neurons and can replicate in brains. The virion comprises three major structural elements: a nucleocapsid containing the 152-kbp genome, an envelope consisting of a lipid bilayer with embedded glycoproteins, and a proteinaceous tegument in between (2). The capsid is an icosahedral shell of 1,250-Å diameter enclosing a double-stranded DNA (dsDNA) genome (3). HSV-1 produces branched concatemeric viral DNA in the nuclei of infected cells.

Individual genomes are generated by virally encoded machinery that recognizes packaging signals in concatemeric DNA and endonucleolytically cleaves the DNA within these signals, and the cleavage is tightly coupled to insertion of DNA into a preformed protein shell called procapsid (4–8). Viral antigens and nucleic acids were also detected within these structures by immunofluorescence microscopy and in situ hybridization, respectively. The viral DNA is inserted into procapsid through a unique portal vertex, which is composed of a dodecameric ring of pUL6 protein with an internal diameter wide enough to accommodate passage of dsDNA (10–12). As the DNA is packaged into the capsid, it replaces the internal proteinaceous shell or scaffold, and the outer shell undergoes a dramatic and stabilizing conformational change (13, 14). Capsids containing DNA are termed nucleocapsids or type C capsids (15). In a default reaction that occurs in the absence of terminase components, immature capsids (termed procapsids or large-cored B capsids) undergo the conformational change and retain the internal shell (13, 14). Median survival was >10 d for newborns infected with HSV-1 (n = 16), 8 d for newborns infected with HSV-2 (n = 5), and >10 d for adults infected with either HSV-1 (n = 10) or HSV-2 (n = 9).

In instances in which the scaffold is expelled but DNA is absent, type A capsids are produced. Such capsids are believed to result when the DNA-packaging process initiates but is subsequently aborted and the DNA slips out of the capsid. DNA packaging of HSV-1 requires seven protein-encoding genes, namely, UL6, UL15, UL17, UL25, UL28, UL32, and UL33, as identified through genetic analysis (7). Mutations within these genes result in defects either in the cleavage of concatemeric DNA or DNA encapsidation (8, 16, 17). Like many tailed dsDNA bacteriophages, genome cleavage and packaging in HSV-1 are tightly coupled and require a terminase enzyme that harbors the DNA recognition, endonuclease, and ATPase activities (7, 18). Unlike bacteriophage terminases that consist of two subunits, evidence suggests that the herpes simplex virus terminase consists of three protein components encoded by the UL15, UL28, and UL33 genes (19, 20). It was reported that the HSV-1 terminase complex assembled in the cytoplasm, eventually interacting with the portal vertex of the procapsid in infected cell nuclei (21).

Trafficking of HSV-1 terminase proteins into nuclei depends on a nuclear localization signal in the product of the UL15 gene (pUL15) (21). pUL28 has been shown to bind viral DNA-packaging sequences (22), while pUL33 associates with pUL28 and enhances the interaction between the pUL28-pUL33 complex and pUL15 (20). The UL15 gene is composed of two exons separated by an intron of 3,587 bp, and it encodes a 735-residue protein (23, 24). The UL15 gene family of herpesviruses predicts a highly conserved ATPase motif that, at least in the herpes simplex virus, is required for viral DNA cleavage and packaging (25, 26). The structure of the C-terminal domain of the pUL15 ortholog (designated pUL89C) from human cytomegalovirus (HCMV), a beta-herpesvirus, exhibits an RNase H-like nuclease domain fold that is responsible for cleavage of concatemeric DNA into unit-length genomes (27, 28). Here, we report the 2.46-Å resolution crystal structure of the pUL15 C-terminal domain (pUL15C) arranged as a novel trimer. The structure shows a fold resembling those of RNase H, integrases, DNA polymerases, and topoisomerases, indicating that pUL15 utilizes a similar metal ion-mediated catalytic mechanism.

Docking analysis enabled by better-defined surface loops shows a putative DNA-binding surface comprising numerous positively charged residues. Structural comparison with viral terminase nuclease domains and RNase H-like nucleases reveals conserved and variable features in the fold cores and the nuclease active sites, suggesting an evolutionary lineage among eukaryotic and prokaryotic viruses. Chemokine levels in brain homogenates 2 d after IC inoculation with either HSV-1(F) (gray bars) or HSV-2(333) (black bars), in newborn mice of different genotypes or adult wild-type mice. Protein expression and purification.The pUL15C gene encoding residues 471 to 735 was cloned into the pET28b (Novagen, Madison, WI) expression vector between the NdeI and XhoI restriction sites, resulting in pUL15C with an N-terminal His tag. The protein was expressed in Escherichia coli B834(DE3) cells overnight at 15°C to an optical density at 600 nm (OD600) of 2.2. Protein expression was induced by the addition of isopropyl-β-d-thiogalactopyranoside (IPTG) to a final concentration of 1.0 mM at an OD600 of 0.59, and the cells were kept to grow overnight. Cells were harvested at 5,000 rpm, resuspended in a buffer containing 20 mM Tris-HCl (pH 8.5), 500 mM NaCl, and 10 mM 2-mercaptoethanol and sonicated.

Insoluble materials were sedimented by centrifugation (15,000 rpm, 4°C, 60 min), and the supernatant was passed through a 0.45-μm-pore-size filter. Proteins were purified by Ni2+ affinity chromatography followed by size exclusion chromatography on a Sephacryl S-300 column (GE Healthcare) equilibrated in 20 mM Tris-HCl (pH 8.5), 150 mM NaCl, 1 mM EDTA, and 1 mM dithiothreitol (DTT). Crystallization and data collection.The proteins were concentrated using centrifugal filters with a molecular weight cutoff of 10 kDa to 10 mg/ml in 20 mM Tris-HCl (pH 8.5), 150 mM NaCl, 1 mM EDTA, and 1 mM DTT. Native crystals of pUL15C were obtained at 20°C by vapor diffusion in hanging drops containing equal volumes of the protein solution and a reservoir solution with 1 M ammonium citrate and 0.1 M sodium acetate at pH 4.6. The crystals were flash-cooled in 15% polyethylene glycol 400 as the cryoprotectant. The X-ray data were collected at 100 K at the Advanced Photon Source (APS) beamlines GM-CA/CAT 23ID-B and 23ID-D and at the Stanford Synchrotron Radiation Lightsource (SSRL). The data for final structure refinement were collected at SSRL beamline BL 11-1 and were processed with the HKL2000 (29).

X-ray data processing statistics are summarized in Table 1. Structure determination.The structure was determined by molecular replacement with the structure of the HCMV pUL89 C-terminal nuclease domain (47% sequence identity) as the initial search model using the program Phaser incorporated in PHENIX (30). The structure was first determined with X-ray data collected at APS and was later refined with higher-resolution data collected at SSRL. Crystal belonged to space group P43212, with three molecules in the asymmetric unit, and the cell dimensions are a = 96.9 and c = 194.0. The structure was built manually using the program COOT (31), and the refinement was performed with the program PHENIX using noncrystallographic symmetry restraints. The model was improved by alternating cycles of refinement. The final refinement cycles included TLS refinement.
American Society for MicrobiologyJournal of Virology

Refinement statistics are summarized in Table 1. In the final refined structure, residues 476 to 732 were modeled in A, B, and C molecules. Residues 512 to 519 and 544 to 547 were invisible in B and C molecules, and residues 604 to 613 where invisible in all the three chains. Residues 686 to 704 were invisible in A and B molecules, but partial density at a 0.70 sigma cutoff were found in C molecules, and alanine residues were added from 686 to 688 and 693 to 698. In the pUL15C DNA-binding model, a model for the disordered residues in loop L4 (residues 686 to 704) was built based on the C molecule using the COOT program. Nuclease activity assay.The purified pUL15C at various concentrations were incubated with ∼400 ng of supercoiled plasmid DNA (pET20b; 3,716 bp) in a reaction solution containing 20 mM Tris-HCl (pH 7.8), 10 mM NaCl, and 1.0 mM MgCl2 for 1 h at room temperature. The reactions were terminated by the addition of EDTA to a final concentration of 50 mM.

To analyze the effects of EDTA and MgCl2 on pUL15C nuclease activity, different concentrations of pUL15C were incubated with the same plasmid DNA in the presence of 5 mM EDTA or 5 mM MgCl2 in a 10-μl reaction mixture containing 20 mM Tris-HCl (pH 7.8), 100 mM NaCl, and 1 mM DTT. The reactions were terminated as described above and analyzed by 1.0% (wt/vol) agarose gel electrophoresis followed by ethidium bromide staining. Overall structure of pUL15C.The pUL15C crystallizes with three molecules per crystallographic asymmetric unit (Fig. 1A; Table 1). The root mean square (RMS) deviations after pairwise superposition are 0.45 Å, 0.50 Å, and 0.61 Å for 211, 212, and 214 equivalent C-α, respectively, indicating that they are essentially identical. The A molecule is more complete compared to the other two molecules. The Phe512-Gly520 loop (L1) and Lys543-Gly548 loop (L2) are well defined in the electron density map for the A molecule but are missing in B and C molecules (Fig.

1B). The Lys604-Ser613 loop is invisible in the electron density map for all three molecules and thus is disordered. The loop Glu686-Ala704 (L4) is disordered in A and B molecules but displays weak main-chain electron density for C molecule and thus is modeled as poly-alanine between 686 to 688 and 693 to 698 in the C molecule. These loops are located in close proximity to the putative nuclease active site and presumably make contact with the DNA substrate, indicating that these loops are flexible and may become ordered upon DNA binding (Fig. 1B). The three molecules are arranged about a noncrystallographic, approximate 3-fold rotational symmetry axis, and the pairwise rotations between molecules are 119.50 Å, 120.02 Å, and 120.51 Å, respectively. The buried solvent accessible surface areas are 639.3, 871.9, and 974.5 A2, consistent with slight discrepancy from a proper 3-fold symmetry.

Intermolecular interactions involve the N-terminal (α1), C-terminal, α2-β4, and β6-α5 regions, in which loop 3 (residues 665 to 672) plays a major role. There is a channel at the center of the crystallographic trimer that is of ∼10 Å in diameter and is unlikely for passage of DNA. The overall structure of pUL15C. (A) Ribbon representation of the pUL15C trimer viewed down the noncrystallographic 3-fold axis. A, B, and C molecules are shown in green, blue, and pink, respectively. Conserved acidic residues in the active site, D509, E581, D706, and D707, are labeled. (B) Overall structure of pUL15C in a ribbon representation.

The α-helices, β-strands, and loops are in green, pink, and yellow, respectively. The loops L1, L2, L3, and L4 and the N terminus are indicated. (C) The electrostatic potential surface of pUL15C in the same view as shown in panel B. The positive potential is shown in blue, whereas the negative potential is in red. The pUL15C exists mainly as a monomer in solution, although a very small fraction that corresponds to a potential trimer is observed (data not shown). The biological implication of the pUL15C crystallographic trimer is unclear. Terminase large subunits of phages T4 and phi29 assemble into ringlike pentamers upon binding to the procapsid (32, 33), and gpA of phage lambda forms a tetramer in complex with the terminase small-subunit gpNu1 (34).

The pUL89 nuclease domain structure displays a dimer of dimers, and the intermolecular interactions involve regions different from those in pUL15C and is mediated through the central β-sheet (27). Nevertheless, it is interesting to note that the active sites in the crystallographic trimer of pUL15C all face outside (Fig. 1A), making them accessible for potential DNA binding and cleavage. The pUL15C belongs to the RNase H-like endonucleases and polynucleotidyl transferases.The pUL15C molecule measures about 48 by 47 by 42 Å3 and consists of a seven-stranded β-sheet, with parallel and antiparallel strands sandwiched between six α-helices (Fig. 1B). The central β-sheet (β1 to β5) curves around the helix α6, which is situated on the concave face of the central β-sheet. Negatively and positively charged areas disperse along the surface of pUL15C (Fig.

1C). The active-site groove is largely negatively charged, consistent with recruiting of metal ions for DNA binding and cleavage. The core of pUL15C, that is, the central β-sheet (β1 to β5) surrounded by α-helices, exhibits a characteristic fold similar to those of the RNase H-like superfamily of nucleases and polynucleotidyl transferases (35), despite the lack of an apparent amino acid sequence identity (Fig. 2). Structural superposition shows RMS deviations of 2.8 Å for 80 equivalent C-α with 9% identity with RNase H (36), 3.0 Å for 104 equivalent C-α with 7% identity with the Holliday junction resolvase RuvC (37), 3.0 Å for 79 equivalent C-α with 5% identity with RNase H1 (38) (Fig. 2A), and 3.0 Å for 90 equivalent C-α with 4.4% identity with the Tn5 transposase (39) (Table 2). The core folds in these proteins display a conserved 5-stranded mixed β-sheet arranged as β5-β4-β1-β2-β3, with four parallel strands and an antiparallel β2.

Structural comparison of pUL15C with RNase H family nucleases and viral terminase nuclease domains. The pUL15C (green) is superposed with RNase H1 (A; PDB code 2QKB), phage SPP1 (B; PDB code 2WC9), phage T4 gp17 (C; PDB code 3CPE), and pUL89C (D; PDB code 3N4P). In all panels, the other protein is in gray. In panels C and D, the right views are 90° from the left ones. The pUL15C active-site residues are shown as stick models for side chains and are labeled in panel A. The β7 of pUL15C is shown in blue and the hairpin 620 to 633 is shown in pink, both of which are indicated with an arrow. In panel D, the C-terminal region encompassing residues 720 to 732 of pUL15C and the corresponding region of pUL89C are shown in red and cyan, respectively.

The amino and carboxyl termini are indicated with N and C, respectively, in panels C and D.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Bovine herpesvirus type 1 (BHV-1) is an important component of the bovine respiratory disease complex (BRDC) in cattle. SPV was found to confer immunity against the fatal infection produced by LPV in mice and hamsters. Local antibody produced after initial herpesvirus infection may not be required for recovery. The frequency of HSV isolation varied with the anatomic site and the presence or absence of a herpetic lesion. A total recovery was obtained on the 12th day of the treatment. Many strains of the herpes virus produce external blisters and sores on the skin and these are highly contagious and can be transmittable between species. 75:9018-9028, 2001).

Rabbits can acquire a handful of different herpes viruses, but for pet rabbits, the most common infections are caused by Herpes simplex virus 1 (HSV-1), Herpes cuniculi (LHV-4), Herpes cuniculi (LHV-2) and Herpes sylvilagus (LHV-1/LHV-3). Infection with heat-inactivated HSV-2 (moi = 1.0 before heat inactivation) did not prime adult AM for enhanced CL responses. Clinical Signs De meest voorkomende klinische verschijnselen zijn gebonden met een veel te hogen aantal lymfocyten in het bloed (lymfocytosis). Links to PubMed are also available for Selected References. Bloom et al., J. Get a printable copy (PDF file) of the complete article (2.9M), or click on a page image below to browse page by page. Despite antiviral drug therapy, ocular herpes infections are still a major health problem, and no vaccines are available.

M. Hill et al., Virology 174:117-125, 1990; G. HLA transgenic mice, such as HLA-A*0201 and HLA-DR transgenic mice, are powerful models that develop robust T cell responses to human epitopes after immunization or upon ocular HSV-1 infection (10–12). Perng et al., J. Virol. 68:8045-8055, 1994; F. For mild or common strains, your vet can diagnose the disease by observing clinical signs or taking blood or tissue samples and sending them to the laboratory for analysis.
American Society for MicrobiologyJournal of Virology

In addition to animal strain and gender, the strain of the virus can influence the susceptibility to infection by HSV-1. Izumi, E. K. Wagner, and J. G. Stevens, J. Virol.

63:4455-4458, 1989). We therefore hypothesized that the 5′ end of LAT and/or an as yet unidentified gene that overlaps part of this region is involved in viral virulence. We report here on the discovery and initial characterization of a novel HSV-1 RNA consistent with such a putative gene. The novel RNA was antisense to the 5′ end of LAT and was designated AL-RNA (anti-LAT sense RNA). The AL-RNA overlapped the core LAT promoter and the first 158 nucleotides of the 5′ end of the primary LAT transcript. AL-RNA was detected in extracts from neuron-like cells (PC-12) infected with wild-type HSV-1 but not in cells infected with a mutant with the AL region deleted. The deletions in each of the above three mutants with altered virulence encompass the 5′ end of the AL-RNA, and these mutants cannot transcribe AL.

This supports the hypothesis that the AL gene may play a role in viral virulence. Based on comparison to the corresponding genomic sequence, the AL-RNA did not appear to be spliced. The AL-RNA was polyadenylated and contained an open reading frame capable of encoding a protein 56 amino acids in length with a predicted molecular mass of 6.8 kDa. Sera from three of three rabbits infected with wild-type HSV-1 but not sera from any of three rabbits infected with a mutant with the AL-RNA region deleted recognized the Escherichia coli recombinantly expressed AL open reading frame on Western blots. In addition, four of six rabbits infected with wild-type virus developed enzyme-linked immunosorbent assay titers against one or more AL synthetic peptides. The wt BHV-1 BAC clone (pBHV-1 BAC) and the pBHV-1 BAC gEAm453 mutant clone (gE cytoplasmic tail truncated) were maintained in GeneHogs E. ↵*Corresponding author.

Present address: Department of Ophthalmology, University of California Irvine, UCI Medical Center, Bldg. 55, 2nd floor, 101 The City Dr., Orange, CA 92868. Phone: (714) 456-5043. Fax: (714) 456-5073.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology
How alphaherpesvirus capsids acquire tegument proteins remains a key question in viral assembly. In support of the model are the following results. (i) Exposure of cells at the time of or before infection to l-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK), a serine-cysteine protease inhibitor, prevents the release of viral DNA or expression of viral genes. Electron microscopic examination of intact virions revealed that whereas the tegument was asymmetrically distributed around the capsid in extracellular virions, it was symmetrically arranged in cell-associated virus. Examination of virions after treatment with nonionic detergent demonstrated that: (i) in extracellular virus the tegument was resistant to removal with Triton X-100 (TX-100), whereas it was lost nearly completely when cell-associated virus was treated in the same way; (ii) the tegument in TX-100-treated extracellular virions was asymmetrically distributed around the capsid as it is in unextracted virus; and (iii) in some images, tegument was seen to be linked to the capsid by short, regularly spaced connectors. Similar studies with antibodies specific for nucleoporins demonstrated attenuation by antibodies specific for Nup358 but not Nup214. Smith, J.

Transfer of the isolated motif to a test protein, β-galactosidase, conferred specific nuclear localization. Several tegument proteins prime the cell for virus infection by shutting off cellular protein synthesis (virion host shut-off factor, pUL41) (29) or, after translocation into the nucleus, boost viral transcription (α-transinducing factor, pUL48) (2). Commonly studied members of the alphaherpesvirus subfamily include the human pathogens herpes simplex virus (HSV) and varicella-zoster virus (VZV) and the animal pathogens pseudorabies virus (PRV), bovine herpesvirus, and Marek’s disease virus. Following reactivation, progeny viral particles travel anterogradely from the ganglia toward the nerve terminals, resulting in reinfection of the dermis or other innervated tissues. Pseudorabies virus (PRV) is a swine alphaherpesvirus closely related to the human pathogens herpes simplex virus type 1 and 2 (HSV-1 and HSV-2) and varicella-zoster virus (VZV) (96, 113).

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

To persist in latently infected, proliferating cells, Kaposi’s sarcoma-associated herpesvirus (KSHV) episomes must replicate and efficiently segregate to progeny nuclei. In these tumors, KSHV establishes a latent infection in many of the rapidly proliferating and morphologically abnormal cells. Only a few viral gene products are expressed by the latent virus, and one of the best characterized is the latency-associated nuclear antigen (LANA), a nuclear protein required for the maintenance of viral episomal DNA in the dividing host cell. We have reported that the latency-associated nuclear antigen (LANA) can repress RTA (for replication and transcription activator) expression by down-regulating its promoter. Here, we show that transcription of LT cassette mRNA can be induced by RTA through the activation of a second promoter (LTi) immediately downstream of the constitutively active promoter (LTc). The 140-kbp KSHV long unique region encodes approximately 90 genes, which are flanked on both sides with 20 to 40 copies of 801-bp-long GC-rich terminal repeats (TR) (20, 24, 29). 75:3948-3959, 2001).
American Society for MicrobiologyJournal of Virology

RBP-Jκ binding sites within the RTA promoter have been found to be critical for LANA-mediated repression. This decisive signaling network includes ATM (ataxia telangiectasia mutated) and ATR (ataxia telangiectasia and Rad3 related), which transduce the DNA damage signal, and the effector UV-DDB (UV-damaged DNA binding protein complex), which elicits a DNA repair response. Howley, Cell 117:349-360, 2004, and J. Infection of UNG−/− and wild-type mouse embryonic fibroblasts with KSHV did not reveal any difference; however, UNG−/− cells produced a significantly reduced number of virion particles after induction. Primarily, KSHV has been strongly associated with KS, primary effusion lymphoma (PEL), and multicentric Castleman’s disease (40). KSHV RTA is the key viral regulator of KSHV reactivation (18, 22). Of the at least 90 genes encoded by KSHV, only a few are expressed during latency (52).

LANA is expressed from a latently controlled 5.32-kb transcript that also encodes the viral cyclin (v-Cyc) and v-FLIP (12). E-mail: kkaye{at}rics.bwh.harvard.edu.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Previous results have indicated that the herpes simplex virus 1 UL31 and UL34 proteins interact and form a complex at the inner nuclear membranes of infected cells, where both play important roles in the envelopment of nucleocapsids at the inner nuclear membrane. The presence of a bulky side chain, such as tyrosine at position 167, would not be sterically favorable for pyrimidine or pyrimidine nucleoside analogue binding, whereas purine nucleoside analogues would be less affected because they are located further away from the phenylalanine side chain. Further, in vitro studies demonstrated that a recombinant expressed US11 protein binds PKR, blocks the phosphorylation of the α subunit of eukaryotic initiation factor 2 (eIF-2α) by activated PKR, and, if provided prior to PKR activation, precluded PKR autophosphorylation. Virus carrying this mutation should synthesize gB molecules lacking the last 41 amino acids of the cytoplasmic domain. This was the result of a severe deficiency in viral gene and protein expression. Their designations refer to the amino acids deleted by the mutation. Hep2 cells infected with v3480 contained the UL34 protein in the cytoplasm, the nucleus, and the nuclear membrane, and this was noted to be similar to the appearance of cells infected with a UL31 null virus.

An X-ray structure of gB suggested that it is a class III fusogenic glycoprotein with internal fusion loops (6), and evidence that these loops can associate with lipid membranes was presented recently (5). In these studies, we tested whether the HCMV UL80.5 gene would substitute for the HSV UL26.5 gene in a baculovirus capsid assembly system that we have previously described (D. These sites could represent site-specific epitopes in the gB polypeptide. PILRα also binds to CD99, which is expressed mainly on T-cell subsets (12). This result is similar to the results obtained with the UL20p carboxyl terminal domains and suggests that amino terminal domains of UL20p that function in cytoplasmic virion envelopment can be functionally separated from those that function in UL20p and gK intracellular transport and TGN localization. Here, we addressed whether O-glycans on gB are involved in the association between PILRα and gB. One approach was to use benzyl-α-GalNAc, which specifically blocks the extension of O-glycans through its ability to compete with GalNAc-O-Ser/Thr, a substrate for β1-3-galactosyl-transferases, which generate core 1 structures of O-glycans (8).

293T cells transfected with gB (HSV-1 strain KOS) were treated with benzyl-α-GalNAc (Sigma) at 37°C for 48 h and were then stained with PILRα-Ig (15) or anti-gB monoclonal antibody ([MAb] clone 1105; Rumbaugh-Goodwin Institute) (Fig. 1A). VP16 is a modular protein and contains separable domains that are important for complex formation and transactivation(19, 23, 24, 25, 26, 27, 28, 29). Because benzyl-α-GalNAc functions competitively, the weak binding of PILRα-Ig to benzyl-α-GalNAc-treated gB transfectants might have been due to an insufficient effect of benzyl-α-GalNAc on O-glycans. Benzyl-α-GalNAc did not affect the viability of cells (data not shown). One common feature is that these viruses all have internal scaffolding proteins that are not present in the mature virion but are required for the formation of the precursor capsid prior to encapsidation of the genome. vhs, a 489-amino-acid phosphoprotein that, like VP16, exists as a preformed viral structural component, disables host protein synthesis and triggers mRNA degradation following infection (13, 24, 25, 35, 40, 43, 47, 52).

The mechanisms by which Vhs affects pathogenesis are unclear but may involve a role in reducing the expression of major histocompatibility complex class I (69) or suppressing cytokine production by infected cells (67). Thus, the presence of O-glycans on gB is critical for the interaction between PILRα and gB, as it is for the interaction between PILRα and CD99 (15). In restrictive cell types such as Vero cells, a UL31 null virus produces 1,000-fold fewer extranuclear particles than the wild-type virus, reminiscent of the phenotype of a UL34 null virus, suggesting that both proteins play important roles in primary envelopment (8, 20). The ratio of catalytic capacity of the mutant TKs with GCV or ACV versus dThd increased up to 11-83-fold or 70-567-fold, respectively (4). The nitrocellulose filter was next incubated with an appropriate alkaline phosphatase- or peroxidase-conjugated antibody diluted in blocking solution for approximately 90 min. gB-transfected 293T cells treated with neuraminidase (Vibrio cholera; Roche) at 37°C for 3 h were not recognized by PILRα-Ig, whereas nontreated cells were recognized by PILRα-Ig (Fig. Vero, E5, D14, and I3 cells (African Green monkey kidney cells) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 5% fetal bovine serum (FBS) and maintained as suggested by ATCC.

Neuraminidase treatment did not affect the binding of nectin-Ig to gD transfectants or the cell surface expression of gB and gD. Four to 10% of the amino acids of PILRα are identical to Siglec (sialic acid-binding Ig-like lectin) family proteins, which recognize sialic acids on glycans (15). An arginine residue that is essential for sialic acid recognition by Siglecs is conserved in PILRα. Indeed, PILRα-Ig with this arginine residue mutated did not recognize gB or CD99 (data not shown). These results suggest that sialic acids on gB are involved in the recognition of gB by PILRα, as they are in the recognition of CD99 by PILRα. Along with the result that O glycosylation on gB is important for association with PILRα, sialylated O-glycans on gB are involved in the interaction with PILRα. We analyzed the glycosylation sites on gB that are responsible for recognition by PILRα.

Although the NetOGlyc 3.1 algorithm (www.cbs.dtu.dk/services/NetOGlyc/) is useful in predicting potential O glycosylation sites, prediction of O glycosylation sites is still imprecise. The NetOGlyc 3.1 algorithm predicted seven threonine or serine residues (threonines at 37, 44, 53, 64, 67, and 480 and serine at 487) to be potential O glycosylation sites. Of note, five threonines were located near the N terminus. In order to analyze whether this N-terminal region is involved in recognition by PILRα, we constructed a gB chimeric molecule (gB30-115) possessing a BM-40 signal sequence (amino acid residues 1 to 40), a Flag-tag, an N-terminal gB fragment from its signal peptide cleavage site (amino acid residues 30 to 115) containing the five possible O glycosylation sites, and a transmembrane region of mouse PILRα (amino acid residues 196 to 256; GenBank accession number, NM_153510) to serve as an anchor to cellular membranes. Fusion proteins were purified from induced cultures of Escherichia coli DH5α by affinity chromatography on amylose resin according to the manufacturer’s instructions (New England Biolabs). 2). In order to identify the amino acid residues of gB that are involved in association with PILRα, we generated a series of mutations of the N-terminal gB fragment.

These included a predicted α-helical domain lying in the center of the protein between residues 164 and 219, a region within residues 54 to 164 on the N-terminal side of the central domain, and another on the C-terminal side. Mammalian cell culture.Vero, COS-1, and 16-8 cells were propagated and maintained in Dulbecco’s modified Eagle medium containing 1% l-glutamine and 1% penicillin-streptomycin and supplemented with 10% calf or fetal bovine serum. Cells.Vero cells were purchased from the American Type Culture Collection and maintained in Eagle’s minimum essential medium (GIBCO) supplemented with 10% (vol/vol) calf serum and antibiotics as described previously (17, 46, 51). Furthermore, the binding of PILRα-Ig to the A53T gB30-115m revertant was abrogated by sialidase or benzyl-α-GalNAc treatment (data not shown). To include sequences sufficient to promote translation of the gene, we PCR amplified a full-length UL34 fragment from pJB253 by using the primers 5′ GTA CTC GAG ATA TGG CGG GAC TGG GCA AG 3′ and 5′ GTG CTC GAG AGG GCT GTG TGG GGC GAA GGC GTC 3′. Transfected bacteria were grown overnight in 2YT (yeast/tryptone) medium containing ampicillin (100 μg/ml) and chloramphenicol (40 μg/ml) and then diluted in fresh medium. The lower one-third of the supernatant was discarded, and the S100 pellet was resuspended in 100 μl of isotonic buffer (25 mM HEPES, 115 mM KCl, 1 mM spermidine, 10% glycerol); 50 μl of threefold-concentrated 0.3 M salt wash buffer (25 mM HEPES, 785 mM KCl, 15 mM Mg[OAc]2, 1 mM spermidine, 3 mM dithiothreitol [DTT], 10% glycerol) was added, and the mixture was incubated with a stir bar overnight at 4°C.

3A). Metabolic labeling experiments were performed as previously described (23, 24) with the following modifications. Interestingly, gB with a mutation at threonine 480 (T480) in addition to T53 (T53AT480A) was not recognized by PILRα, whereas, similar to T53A gB, gB with an additional mutation at serine 487 (T53AS487A) was recognized by PILRα-Ig. gB with a mutation at T480 alone (T480A) was recognized by PILRα, as was WT gB. None of these mutations affected the cell surface expression of gB. Similar results were obtained using several other cell lines, such as COS cells (data not shown). These data suggest that two O glycosylation sites of gB, T53 and T480, are involved in the association with PILRα.
American Society for MicrobiologyJournal of Virology

Both T53 and T480 are located in a proline-rich region, which may be important for protein folding (16). It has been reported that functional gB forms oligomers (1, 3, 6). Therefore, we analyzed whether the point mutations of gB affected oligomer formation. The oligomeric structure of gB is resistant in sodium dodecyl sulfate (SDS) sample buffer but is denatured by boiling (9). As shown in Fig. 3B, there was no difference in SDS resistance between WT gB and the mutated gBs. The mammalian expression vector pEVRF65 contains the full-length VP16 open reading frame under transcriptional control of the cytomegalovirus IE promoter.

Moreover, there was no difference in the molecular weight between WT and mutated gB or in cell surface expression. Because the molecular weight of gB is relatively high and gB has several N glycosylation sites, mutations of one or two O glycosylation sites alone did not affect the total molecular weight of gB. The gene with defects in domains 1, 2, and 4 was obtained by ligating the larger BsmI-KpnI fragment from the plasmid carrying the domain 1 mutant gene to the smaller BsmI-KpnI fragment from the plasmid containing the gene with mutations in domains 2 and 4. Solid-phase capture assays.Glutathione-S-transferase (GST) fusion protein expression plasmids containing wild-type or the various mutant derivatives of VP16 were constructed in pGEX2T (Pharmacia) and transformed into BL21(DE3) cells (Stratagene). The precipitates also contained enough salmon sperm carrier DNA to bring the total amount of DNA to 12 μg. However, it is noteworthy that only O glycosylation sites at T53 and T480 are involved in association with PILRα. A UL34 fragment (encoding aa 209 to 275) was PCR amplified by use of the primers 5′ GGA TCC TGG GGG TGG CCG GAA CG 3′ and 5′ GCG GTC GAC AGG GCT GTG TGG GGC GAA GGC GTC 3′, and the amplicon was cloned into pCR2.1.

Modeling Studies—The Protein Data Bank-coded HSV-1 TK structures 1E2J (10) and 1K12 (11) complexed, respectively, with dThd and GCV were overlaid using the COOT model-building tool for molecular graphics (12). As demonstrated in Fig. gBs were immunoprecipitated with anti-gB MAb, and the azido-GalNAc incorporated into gB was treated with phosphine-Flag, which specifically reacts with the azido-GalNAc (11), followed by detection with anti-Flag MAb by Western blotting. Trypan blue staining for intact nuclei was performed to assess the efficiency of cell lysis. 4). In contrast, there was no significant difference in the total amount of gB expressed. This result suggests that T53 and T480 of gB are O glycosylated.

However, weak detection of O-glycans on the T53AT480A gB suggest the presence of O glycosylation sites other than T53 and T480 on gB. PILRα specifically associates with HSV-1 gB (10), but not with other HSV-1 glycoproteins, although some other envelope proteins are known to be O glycosylated. Recently, it was shown that insertion mutations in gB could reduce the binding of gB to PILRα, suggesting that the conformation of gB is also involved in the interaction (2). Therefore, PILRα does not associate with glycans alone and seems to recognize both protein structure and O-glycans (13, 15), which may be a reason that PILRα specifically associates with gB. It is interesting that both T53 and T480 are involved in the interaction with PILRα, because these two residues are widely separated on the polypeptide chain. Because PILRα bound to gB by Western blotting, PILRα might recognize linear epitopes in gB; therefore, PILRα might bind to the two sites in gB independently. Alternatively, elements of higher-order structure retained in the unreduced samples examined by SDS-polyacrylamide gel electrophoresis (PAGE) (Fig.

1B) could have been necessary for the binding of PILRα-Ig to the blots. The above mutant derivatives were cloned into the MBP expression vector pMal-C, expressed in E. Determination of the structure of gB associated with PILRα will facilitate understanding the mechanism of membrane fusion during HSV-1 infection. Requirement of sialylated O-glycans on gB for the interaction with PILRα. (1). This subregion also contains determinants required for interaction with HCF-1 and Oct-1, and for VIC assembly (Fig. These consist of amino-terminal and carboxyl-terminal regions of approximately 100 amino acids and a conserved internal region (Fig.

(B) Total cell lysates of mock (M)- or gB-transfected 293T cells treated with benzyl-α-GalNAc at the indicated concentrations were separated by SDS-PAGE, followed by blotting with anti-gB antiserum (R74; see reference 2) or PILRα-Ig. The final PCR product was ligated into pCR2.1, removed with XhoI, and ligated into the XhoI site of pCDNA3. Similar to the Ala-167 mutants, the amino acid changes with less-bulky side chains showed virtually no compromised GCV kinase activity but a more pronounced attenuated dThd kinase activity. These data indicate that deletion of amino acids 88 to 152 of the US11 protein completely eliminated the US11-PKR interaction while deletion of amino acids 91 to 121 largely eliminated the US11-PKR interaction. Mutational analyses of O glycosylation sites in the N terminus domain of gB. The cells were pelleted by low-speed centrifugation, resuspended in 500 μl SDS-lysis buffer, (1% SDS, 10 mM EDTA, 50 mM Tris HCl [pH 8.1]), and incubated on ice for 30 min. The transfectants were stained with control Ig (dotted line) or PILRα-Ig (solid line).

Expression of the N terminus domain of gB was analyzed by staining with anti-Flag MAb (solid line) or control MAb (dotted line). Histograms show fluorescence intensity measured in arbitrary units on a log scale (x axis) and relative cell number on a linear scale (y axis). Mutational analyses of O glycosylation sites of full-length gB. (A) 293T cells were transfected with various mutated gBs, and the transfectants were stained with control Ig (dotted line) or PILRα-Ig (solid line). Expression of gB was analyzed by staining with anti-gB MAb (solid line) or control MAb (dotted line). The histograms show fluorescence intensity measured in arbitrary units on a log scale (x axis) and relative cell number on a linear scale (y axis). (B) Membrane proteins prepared from COS-7 cells transfected with WT gB and mutated gBs were boiled or left unheated in SDS sample buffer in reducing or nonreducing conditions, respectively.

Samples were separated by SDS-PAGE, followed by blotting with anti-gB MAb. Analysis of O-glycans on WT and mutated gB. O-glycans on gB expressed on 293T cells were metabolically labeled with Ac4GalNAz and were then immunoprecipitated with anti-gB MAb. B, gel retardation experiments were carried out with the indicated fusion proteins (6 μg) in the presence of purified GST-Oct-1 POU homeodomain fusion protein (0.05 μg; referred to as Oct-1 in all figures). The labeled O-glycans and total amount of gB were detected by anti-Flag or anti-gB MAb, respectively. This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan (Y.K. Subsequently, the corresponding single amino acid changes were made individually in domain 1.

The left lane of panel B represents 30% of the total input radioactivity used in each of the binding assays. No obvious homology was observed between the cellular nucleases and the conserved carboxyl-terminal region of the Vhs proteins. is an American Cancer Society Research Professor.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Herpes Zoster is produced by reactivation of latent Varicella Zoster Virus from the dorsal root ganglion of sensory nerves. Deletion of ORF63 impairs virus replication in cell culture and establishment of latency in cotton rats. Shingles is caused by the varicella-zoster virus, which is the same virus that causes chickenpox. Through a primary screening of VZV genes, we found that ORF61 inhibited SeV-mediated activation of IFN-β and ISRE (IFN-stimulated response element) promoter activities but only slightly affected NF-κB promoter activity, implying that the IFN-β pathway may be blocked in the IRF3 branch. Vitrectomy was performed in all cases of secondary rhegmatogenous retinal detachment (RD). A threefold increase in ORF62 protein was observed in cells infected with the ORF63 deletion mutant compared with those infected with parental virus. Both patient groups showed sustained improvement in American College of Rheumatology responses, swollen joint counts, Health Assessment Questionnaire disability index scores, and C-reactive protein levels.

Furthermore, longitudinal screening in allogeneic stem-cell transplantation patients showed strong expansions of memory T cells recognizing glycoproteins B and E after onset of herpes zoster, while immediate early protein 62 reactivity remained moderate. Cohen, T. Krogmann, S. Bontems, C. Sadzot-Delvaux, and L. IE4 protein resembles its herpes simplex virus (HSV) homolog, ICP27, in its C-terminal residues (38% in amino acids 235 to 449) and complements ICP27 functions in this region, but it does not repair full deletions of the ICP27 gene (8, 9). Virol.

79:5069-5077, 2005) showed an increase in ORF62 transcription compared with those infected with parental virus. In contrast, cells infected with an ORF63 mutant that is not impaired for replication or latency showed ORF62 RNA levels equivalent to those in cells infected with parental virus. The ability of ORF63 to downregulate ORF62 transcription may play an important role in virus replication and latency. Varicella-zoster virus (VZV) causes chicken pox upon primary infection and then establishes latency in cranial nerve and dorsal root ganglia and can reactivate to cause shingles (herpes zoster). The lifetime risk of shingles is 10 to 20% for adults in the United States who are seropositive for VZV (14). Your GP may also suggest the following treatments to ease your symptoms: Take paracetamol to relieve any pain from the rash. This might be explained by the evidence provided by one group that the production of IFN-β may be blocked by ORF62 during VZV infection (40).

American Society for MicrobiologyJournal of Virology
ORF63 protein has also been detected in latently infected human (25, 31, 33) and rodent (11, 22) ganglia. ORF63 encodes a virion tegument protein (28, 38), but the function of this protein is unclear. ORF63 protein enhances the activation of the minimal gI promoter by VZV ORF62 protein (32) and represses other viral genes (3, 20). In transient-transfection assays, ORF63 protein represses promoters containing typical TATA boxes (12), including VZV ORF4 and ORF28, heterologous viral promoters, and the human interleukin-8 promoter. The VZV gI promoter, which contains an atypical TATA box, is only slightly repressed. In contrast, ORF63 protein activates the cellular elongation factor 1 (EF-1) alpha promoter in some cell types (53). A recombinant VZV in which 90% of both ORF63 and its duplicate gene, ORF70, are deleted is viable but impaired for growth in cell culture and latency in cotton rats (5).

Analysis of additional ORF63 mutants showed that viruses that are impaired for replication in cell culture are also impaired for latency, while mutants that are not impaired for replication establish latencies at frequencies and copy numbers similar to those of parental virus (6). The plasmids, pLITMUS-Fsp11kb and pCR-ORF4C, were digested with PacI and NcoI and were ligated to generate pLITMUS-ΔIE4. We found that ORF63 downregulates transcription of ORF62 and that cells infected with VZV mutants impaired for replication and latency show increased transcription of ORF62, while cells infected with a mutant that is not impaired express wild-type levels of ORF62. Cells and viruses.Human diploid fibroblasts (MRC-5) were obtained from the American Type Culture Collection. Cell-free virus was prepared from VZV-infected human diploid fibroblasts (49). Briefly, equal numbers of cells were infected with cell-associated VZV and harvested when a near-maximal cytopathic effect (CPE) was observed, at approximately 36 h. Cell pellets were resuspended in SPGC (146 mM sucrose, 6 mM sodium glutamate, 10% fetal bovine serum in phosphate-buffered saline) and disrupted by sonication, and the sonicate was centrifuged at 1,400 × g (3,000 rpm) for 10 min.

The supernatant was used as the source of cell-free virus. VZV ROka (recombinant Oka), ROka63D (5), ROka63-AccI, ROka-63-5M, and ROka63-KpnI (6) were grown in human melanoma (MeWo) cells by cocultivation of infected and uninfected cells. A rabbit anti-enhanced yellow fluorescent protein (EYFP) PAb was purchased from Santa Cruz Biotechnology, Inc. All adenovirus constructs were grown in human kidney epithelial 293 cells. Electron microscopy.Melanoma cells were infected with ROka or ROka63D at a ratio of one infected cell to six uninfected cells. When an extensive CPE developed (48 h postinfection for ROka or 72 h for ROka63D), cells were scraped into phosphate-buffered saline and fixed in 2.5% glutaraldehyde for 2 h at 4°C. Cell pellets were washed three times in cacodylate buffer and stored overnight at 4°C before postfixation in 1% osmium tetroxide.

Cells were stained with 2% aqueous uranyl acetate, dehydrated in graded ethanols, and embedded in plastic resin. Ultrathin sections were collected, mounted on 200 mesh copper grids, and stained with Reynold’s lead citrate. The grids were examined with a Hitachi H-7000 transmission electron microscope. Immunoblotting.Cells were lysed in radioimmunoprecipitation assay buffer (10 mM Tris-Cl [pH 8], 100 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% deoxycholic acid, 0.5% sodium dodecyl sulfate [SDS]) containing complete protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN), and proteins were separated on 4 to 20% SDS-polyacrylamide gels. As shown in Fig. Human gene microarray analysis.Human diploid fibroblasts were infected with Ad63 or Adblank at a multiplicity of infection of 10. Infection of virtually all cells was confirmed by fluorescence microscopy showing GFP expression.

Forty-eight hours after infection, cells were harvested and stored as cell pellets at −70°C. Four identical experiments were performed on different days, and the cell pellets were processed in parallel. Total RNA was extracted from the cell pellets using the RNeasy mini kit (QIAGEN, Valencia, CA). Double-stranded DNA was synthesized using Superscript II (Invitrogen, Carlsbad, CA) and a T7-(dT)24 primer (Proligo, Boulder, CO), followed by Escherichia coli DNA polymerase I. The cDNA was used as a template for in vitro transcription of biotin-labeled RNA using a BioArray high-yield RNA labeling kit (Enzo, Farmingdale, NY). The HEK 293T cells were plated onto 24-well dishes (Corning, NY) in DMEM (Gibco-BRL) with 10% FBS at a density about 1 × 105 cells per well overnight before transfection.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Determination of the pUL43 expression pattern and degradation by lysosomes. (A) Cells expressing EGFP-labeled β-1,4-galactosyltransferase, a Golgi marker (green). The orientation of proteins was simulated by using SOSUI (http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html). Representative dot plots are derived from three independent experiments. In addition, we show that EHV-1 enters peripheral blood mononuclear cells predominantly via the endocytic pathway, whereas in equine endothelial cells entry occurs mainly via fusion at the plasma membrane. (F) Representative gel from RFLP analysis. Recent experimental studies have identified a single nucleotide polymorphism (SNP) within the EHV-1 gene encoding the viral DNA polymerase (open reading frame-30 [ORF30]) that is highly associated (p {LT} 0.0001) with the viral attribute of neuropathogenicity for horses.6 Of the 32 investigated outbreaks of EHV-1 neurological disease that occurred in the United States and the United Kingdom between 2001 and 2006, 30 (94%) were caused by the ORF30 mutant strain of EHV-1 (G.

Three days after infection, images of at least 80 plaques for each virus were acquired with a camera. IMPORTANCE EHV-1 is widespread throughout the world and causes substantial economic losses through outbreaks of respiratory disease, abortion, and myeloencephalopathy. (A) Equine NBL6 cells were infected with vAb4G or vUL43STOP virus at an MOI of 3. EHV-1 can cause respiratory disease, abortions in pregnant mares, neurologic disease, and in severe cases, death. He is also Secretary of the Racing Medication and Testing Consortium. (B) vAb4G, vUL43STOP, or vUL43STOP_R virus was used to infect NBL6 cells at an MOI of 3. Surface MHC-I levels were measured after 6 h p.i., as described above.

(C) At 16 h p.i., HEK293 and HeLa cells infected with vAb4G or vUL43STOP virus were probed with mouse anti-HLA class I (W6/32) MAb and subjected to flow cytometry. (D) NBL6 cells were exposed to infection with the vHA-UL43 mutant. Concerned owners should consult with their veterinarian prior to taking any action as the clinical signs of infection with the neurological form of EHV-1 (EHM) are common to many other diseases. All experiments were independently performed in triplicate and analyzed by using the Student t test. Data are presented as means ± standard deviations (error bars). Asterisks represent statistical significance (P < 0.05). ns, not significant. Effects of pUL43 on virus replication and cell-to-cell spread. (A) Single-step growth kinetics. NBL6 cells were infected with the parental virus vAb4G, vUL43STOP, or the vUL43STOP_R revertant at an MOI of 3. At the indicated times following infection, supernatants and cell pellets were harvested for determination of extracellular and intracellular titers, respectively. Data are from triplicate measurements and expressed as means ± standard deviations (error bars). (B) Comparison of plaque sizes. Individual viruses were used to infect RK13 cells at an MOI of 0.0001 and overlaid with methylcellulose. Three days after infection, images of at least 80 plaques for each virus were acquired with a camera. The plaque diameter of vAb4G was set as 100%, and the relative plaque sizes for other viruses were then calculated. A representative phenotype of a viral plaque is shown (green). Statistical significance (P < 0.05) is indicated by the asterisk. Determination of the pUL43 expression pattern and degradation by lysosomes. At some point, though, the virus can be reactivated in the carrier horse – who can now spread the disease to others. Cells were mock infected or infected with vHA-UL43 at an MOI of 3 in the absence or presence of PAA. Samples were harvested at different times postinfection. (B) Lysosomes rather than proteasomes are responsible for degradation of pUL43. After infection, cells were maintained in culture medium supplemented with 150 μM chloroquine or 5 μM lactacystin, respectively, for 12 h and 16 h. (C) pUL43 is an early gene product and subjected to lysosomal degradation during infection. We are especially sad since this was our 40th Anniversary Celebration – but not to worry, we are committed to re-scheduling our show for a later date in 2015 and sincerely hope that you will make plans to join us for our ColorPalooza show in 2015 – check back often or keep an eye on our Facebook postings regarding the new date. To detect proteins, cell lysates were prepared in RIPA buffer. After separation by SDS-12% PAGE, proteins were transferred onto PVDF membranes and incubated with anti-HA MAb, anti-gM MAb, or anti-pIR6 PAbs. The immunoblots were developed by enhanced chemiluminescence. β-Actin was included as a loading control. Molecular mass markers were run for each blot in parallel, and sizes are indicated in kilodaltons. Subcellular localization of pUL43 and role of TM domains at the C terminus. (A) Cells expressing EGFP-labeled β-1,4-galactosyltransferase, a Golgi marker (green). (B) Cells expressing EGFP-labeled calreticulin, an ER marker (green). The two cell lines were mock infected or infected with vHA-UL43_M virus. American Society for MicrobiologyJournal of Virology

At 6 h p.i., samples were fixed with 3.5% PFA in PBS and then permeabilized with 0.1% Triton X-100. A confocal laser scanning microscope was used to visualize the expression of pUL43 after sequential incubation with anti-HA MAb and Alex Fluor 568-conjugated goat anti-mouse IgG (red). Azab, unpublished data). (C) Domains of pUL43 homologues and phylogenic analysis. Putative TM domains were predicted with SOSUI (http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html). Identical amino acids are highlighted in black after multiple-sequence alignment with ClustalW 2.0 (http://www.ebi.ac.uk/Tools/msa/clustalw2). The RxR and RLAA motifs are underlined with solid and dotted lines, respectively.

Sequences of pUL43 proteins were derived from GenBank, including EHV-1 (GenBank accession number YP_053062), EHV-4 (accession number NP_045234), PRV (accession number AFI70808), VZV (accession number NP_040138), Marek’s disease virus (MDV) (accession number YP_001033972), HSV-1 (AER37980), and HSV-2 (NP_044513) proteins. The phylogeny tree was constructed by using the unweighted-pair group method using average linkages, after 10,000 bootstraps were executed by using the MEGA 6.0 toolkit. The identity and similarity of the amino acid (aa) sequences were calculated by using the SIAS online tool with default settings (http://imed.med.ucm.es/Tools/sias.html). (D) Expression of pUL43 and the truncated mutant lacking 4 TM domains at the C terminus. At 24 h after transfection with the indicated plasmids (green), cells were fixed and stained with DAPI (blue). Images were acquired by using an upright fluorescence microscope under a 100× oil objective. Bar, 5 μm.

The hydrophilic domain at the N terminus plays a critical role in MHC-I downregulation mediated by pUL43. (A) Putative structures of pUL43 and its mutant lacking the N-terminal 40 amino acids. The orientation of proteins was simulated by using SOSUI (http://harrier.nagahama-i-bio.ac.jp/sosui/sosui_submit.html). Cells were infected with vHA-UL43 or mutant vHA-ΔN-UL43 virus. At 6 h p.i., cells were incubated with anti-HA MAb and visualized after staining with Alex Fluor 568-conjugated goat anti-mouse IgG (red) and DAPI (blue). Coverslips were inspected with a 100× oil objective. Bar, 5 μm.

(B) vHA-UL43, vHA-ΔN-UL43, or vUL43STOP was used to infect NBL6 cells for 6 h. Levels of cell surface MHC-I were measured by flow cytometry, and triplicate assays were performed independently. Data are expressed as means ± standard deviations (error bars). Differences between various treatments were evaluated by Student’s t test. The asterisk represents a significant level (P < 0.05). ns, no significant difference. The cornea is the tissue on the surface of the eye that is normally clear/transparent. (A) Deletion of both pUL43 and pUL56 does not induce an additional increase of MHC-I expression. NBL6 cells were infected with individual viral mutants at an MOI of 3. At 6 h p.i., levels of cell surface MHC-I were measured by flow cytometry. There is no significant difference between single- and double-deletion mutants. The asterisk indicates statistical significance (P < 0.05). (B) Strategy of engineering the coexpression vectors with a self-cleavable EGFP marker. The P2A sequence was inserted between pUL56 and EGFP. The fragment of pUL56-P2A-EGFP was subcloned into the pVITRO-UL43 vector after digestion with BamHI and XbaI. (C) Sequence alignment and detection of the coexpression vectors. Mutations are highlighted in boldface italic type. HEK293 cells were transfected with the indicated vectors. At 24 h, expression of individual genes was detected by immunoblotting (IB) following incubation with anti-HA MAb and anti-pUL56 PAbs, respectively. β-Actin was used as a loading control. (D) Downregulation of MHC-I caused by pUL43 and pUL56. HEK293 cells were transfected with 500 ng of different expression plasmids. At 24 h, cells were harvested and processed for flow cytometry analysis. Anti-HLA class I MAb (W6/32) was used to react with cell surface MHC-I. This allowed the introduction of 5 × 104 PBMC to study leukocyte-endothelial interactions at a flow rate of 0.5 mm/s, which is within the mammalian physiological range of 0.34 to 3.15 mm/s (40). Representative histograms are from three independent assays. (E) Colocalization of pUL43 with pUL56. (Top) HEK293 cells were transfected with plasmid pUL43-pUL56-P2A-EGFP for 24 h. (Bottom) NBL6 cells were infected with vHA-UL43 virus for 6 h. Samples were fixed with ice-cold acetone until the EGFP fluorescence was quenched. After reaction with anti-HA MAb and anti-pUL56 PAbs, the coverslips were stained with Alexa Fluor 488-labeled goat anti-mouse IgG (green) and Alexa Fluor 568-labeled goat anti-rabbit IgG (red). Images were captured by a confocal microscope with a 60× oil objective. Bar, 10 μm.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

U.v. Ultraviolet (UV) B light is known to be a stimulus for the reactivation of herpes simplex virus (HSV) infections. The treated blood is then directly returned to the patient’s bloodstream. Previously, we found that coinfection of wild-type HSV-1 with a panel of RNA viruses resulted in a block to DC activation that was attributable to vhs. Increased recombination frequencies were observed after UV irradiation of the parental viruses, indicating that damaged sites on the HSV-1 genome stimulate genetic exchanges. UV light does bother it. Biological effects include: Increase in: arterial and venous oxygenation, blood pH, lymphocytes, electrical charge on the red blood cell, of bacteriocidal capacity of the blood, hemoglobin, white blood cell count, lymphocytes, phagocytosis ability; Reduction of : cholesterol, creatinine levels, blood lactate, clot formation tendencies, blood viscosity, uric acid levels, fibrin levels, plasma viscosity, surface tension of the blood; Normalization or modulation of: immune status, glucose tolerance , and fibrinolysis.

Received April 16, 2013. In contrast, IRF3 activation was not influenced by vhs. Conclusion: This study indicated that RB/UV treatment was a promising pathogen reduction technique in PC and had limited effects on platelet quality. Taken together, the work presented here (i) describes a novel role for the vhs protein as an inhibitor of the early activation of NF-κB during HSV-1 infection of DCs and (ii) offers a mechanistic explanation of how this protein interferes with DC activation. Herpes simplex virus type 1 (HSV-1) is a highly successful human pathogen belonging to the Alphaherpesviridae subfamily of herpesviruses. Citrate reactions are listed here for historical purposes. J.

The pathology of HSV infection is greatly influenced by the immune status of the host, which impacts both disease severity and the frequency of reactivation (21, 35, 42, 48, 69). Following receptor binding and dimerization of gp130, three distinct pathways mediate the functions of IL-6. this volume; De Fabo and Noonan this volume; Elmets et al. These cells survey peripheral tissues in an immature state and undergo a process referred to as maturation (or activation) upon encounter with virus-associated molecules (5, 32). DC maturation is initially characterized by the secretion of type I and III interferons (IFNs) and proinflammatory cytokines (e.g., interleukin 6 [IL-6], tumor necrosis factor alpha [TNF-α], and IL-12) and regulation of molecules necessary for migration to peripheral lymph nodes (32). En route to these secondary lymphoid organs, the DCs upregulate several costimulatory markers (CD86 and CD80) and load viral antigen onto major histocompatibility complex (MHC) molecules, which in concert serve to stimulate naïve B and T cells (4). Numerous viral proteins are utilized by HSV to evade the host immune response at all stages of the virus life cycle (7, 9, 31, 33, 39, 63).

Nevertheless, HSV infection is generally accompanied by strong cellular as well as humoral immunological responses (1). The significance of HS in viral diseases is also evident from recent reports that polysulfated compounds, HS-binding peptides and HS-mimetic are very effective in blocking viral infections (Rusnati and Urbinati, 2009; Nyberg et al., 2004; Raghuraman et al., 2005; Raghuraman 2007, Tiwari et al., 2009; Tiwari et al., 2011). Functionally, vhs is a viral RNase that is known to preferentially degrade both host and viral mRNA species (14, 44, 45, 49, 51, 59). vhs has been reported to interfere with DC activation during both productive and nonproductive HSV infection (7, 49). At present, the precise mechanism by which vhs acts to silence HSV-induced DC activation remains undefined. VRS was scored before starting the treatment and at the end of the therapeutic period. If it were $9.99, I might buy one.

Interestingly, HSV-1 infection of non-neuronal cells induces the ATM (ataxia telangiectasia mutated) branch of the DNA damage pathway and abrogation of components of this pathway leads to a decrease in HSV-1 infection (Lilley et al, 2005). Type I IFNs (IFN-α/β) are critical antiviral factors produced during virus infection (reviewed in reference 60). An initial induction phase results in modest levels of IFN-β expression driven by activation of the transcription factors NF-κB, IRF3, and AP-1. Secreted IFN-β binds to its receptor in both an autocrine and a paracrine manner and signals through the Jak-STAT pathway to activate IRF7, leading to both IFN-α production and an amplification of the initial IFN-β signal. An important additional consequence of IFN-α/β receptor signaling is the induction of several interferon-stimulated genes (ISGs) known to inhibit virus replication. In addition to limiting virus infection, activation of the type I IFN pathway is important for DCs to undergo the maturation process (55, 60). Infection by certain viruses, such as Newcastle disease virus (NDV) and murine cytomegalovirus (MCMV), fail to mature DCs when these cells are generated from IFN receptor (IFNR) knockout (KO) mice, highlighting a crucial role for type I IFN signaling in this process (8, 18).

The replication of HSV-1 viruses in which the gene for vhs (UL41) is either mutated or absent is only moderately affected in both transformed and primary cell lines (7, 41). The procedure takes approximately 25 minutes. There is much interest in employing vhs-null viruses as live, attenuated vaccines for HSV due in large part to this replication defect (15, 22, 23, 64). Interestingly, this growth defect is partially overcome when IFN signaling is absent, suggesting that the vhs block of the pathway is important for virus replication and pathogenesis (36). In the second stage, the efficacies of UV light and 50 µM concentration of RB were examined for inactivation of two viruses; Polio virus and Herpes Simplex Virus (HSV). Here, we sought to better understand the early events governing the interaction between HSV-1 and DCs. To achieve this, we utilized a recombinant HSV deficient in host shutoff activity (which strongly activates DCs) as a tool to aid in understanding which molecular pathways are involved in the early activation of DCs following HSV-1 infection.

They may be photosensitizing. Our data show that the vhs protein carried in the virion and delivered into DCs blocks the early replication-independent activation of NF-κB during HSV-1 infection. Viruses, TLR agonists, and infection conditions.KOS 1.1, referred to in this study as KOS, was the wild-type strain of HSV-1 used in all experiments. The dishes were then stained, and the plaques were counted. The leishmaniases are a spectrum of diseases, caused by members of the genus Leishmania, which are obligate intracellular protozoan parasites living with macrophages and monocytes. It contains a deletion of the 588-bp region between SmaI restriction enzyme sites in the UL41 gene. Importantly, this vhs− deletion virus does not incorporate the mutant vhs polypeptide into virions (45).

All viruses were propagated and quantified on Vero cells as previously described (3, 37). For experiments requiring UV-inactivated viruses, viral stocks were exposed to UV irradiation at 10 cm from a germicidal lamp (UVP Multiple-Ray 8-WUV lamp [60 Hz]; Fisher) for 4 min. Nonadherent cells were removed and the adherent cells were cultured in fresh medium with 100 ng/ml human recombinant GM-CSF and 50 ng/ml IL-4 (both gifts from Schering-Plough Research Institute, Kenilworth, NJ). Cells were kept at 37 °C and 5 % CO2. Further, no virus growth was observed during Vero cell plaque assay. Recombinant NDV B1 was generated from the B1 Hitchner avian vaccine strain as previously described (40). Sendai virus (SeV)-HD (strain Cantel) and SeV-LD (strain 52) were grown in 10-day-old embryonated eggs as previously described (68).

UVB may affect the course of PHN through its suppressing effect on the inflammatory response in the acute zoster attack, thus decreasing the neuronal damage contributing to PHN. Lipopolysaccharide (LPS) was obtained from Alexis Biochemicals and utilized at a concentration of 300 ng/ml. The immediate early cytomegalovirus (CMV) promoter was also cloned into the pGL3 plasmid to serve as a positive control for gene expression. RNA viruses were added at an MOI of 1.5. For cotreatment of HSV-1-infected cells with TLR agonists and coinfections with RNA viruses, following HSV-1 treatment, the TLR agonist (or RNA virus) was added to the cells immediately. Previously, we found that mock Vero cell lysate preparations did not activate DCs (7). In this study, where noted, noninfected cells received serum-free medium in parallel with cells that were treated with virus diluted in serum-free medium.

Mice.Wild-type C57BL/6 and Sv129 mice were obtained from Taconic Farms (Germantown, NY). Type I IFNR KO mice were obtained from B&K Universal on the Sv129 genetic background, STAT1 KO mice were obtained from Taconic Farms on the Sv129 background, and MAVS (IPS-1) KO mice were generously provided by Kate Fitzgerald (University of Massachusetts) on the C57BL/6 background with the permission of Zhijian Chen (University of Texas Southwestern). All mice were bred and maintained in our facility consistent with regulations for animal care standard protocols as described by the Mount Sinai School of Medicine IACUC. Cells.Vero cells were grown in tissue culture medium (Dulbecco’s modified Eagle’s medium [Mediatech]) with 10% fetal calf serum (HyClone), 50 μg/ml gentamicin (Invitrogen). All cells were grown at 37°C at 5 to 7% CO2. Murine bone marrow-derived dendritic cells (BM-DCs) were cultured from bone marrow-derived precursor cells as previously reported (29). The samples were drawn aseptically for cell quality analysis on days 2 and 4.

Red blood cells were lysed with ammonium chloride buffer. MHC class II-expressing cells and lymphocytes were removed using a cocktail of antibodies and magnetic-bead separation. Unlike your skin, the mucus membranes of the mouth do not absorb UV rays and this explains why the blood vessels under your tongue are the preferred site for exposing your blood to UV energy. Capture ELISAs.Enzyme-linked immunosorbent assay (ELISA) kits for TNF-α and IL-6 (DuoSet ELISA development systems) were obtained from R&D Systems. ELISAs for mouse IL-12p40 were conducted using capture and secondary antibodies from BD Pharmingen. Briefly, pairs of TG from latently infected WT and KO mice were dissected and DNA was isolated with the Puregene DNA Isolation kit (Gentra Systems, Minneapolis, Minn.). Increases in the amount of solar UV-B reaching the earth’s surface will likely affect the severity of infectious disease.

American Society for MicrobiologyJournal of Virology
Plates were read on an ELISA reader from Bioteck Instruments. Western blotting and antibodies.Protein extracts were generated from infected cell cultures by lysing cells in an NP-40-based lysis buffer containing protease and phosphatase inhibitors and 0.5 M EDTA (Thermo Scientific). Denatured samples were resolved on 10% Tris-Bis gels, transferred to polyvinylidene difluoride (PVDF) membranes, and immunoblotted with antibodies to ΙκΒ-α, phospho-ΙκB-α (Ser32/36), IRF3, and phospho-IRF3 (Ser396) (all obtained from Cell Signaling). GAPDH (glyceraldehyde-3-phosphate dehydrogenase) antibody was obtained from Sigma. Supernatant-treated DCs were then incubated for 16 h and examined for surface phenotype changes. A typical cluster of ZnO MNSs can form a well-ordered array of sea urchin-like structures with filopodia type nanospikes (). Flow cytometry and antibodies.Phycoerythrin (PE)-CD86, fluorescein isothiocyanate (FITC)-CD80, and PE-MHC II antibodies were obtained from BD Pharmingen.

Cells were stained with antibodies and subjected to flow cytometry using the FC500 flow cytometer from Beckman Coulter. Data were analyzed with Flowjo software. qRT-PCR.RNA isolation was conducted on infected and noninfected cell cultures at the indicated time points using the commercially available Absolutely RNA Microprep Kit from Stratagene. RNA was concentrated via precipitation with ammonium acetate. Strong γ-H2Ax induction by the etoposide treatment was shown. cDNA was diluted 50-fold in water. PCRs were conducted in triplicate using specific primers, Platinum Taq Polymerase (Roche), and SYBR green (Roche).

The following primer sequences were used: IFN-λ (IL-28a), sense, 5′-AGGTCTGGGAGAACATGACTG-3′, and antisense, 5′-CTGTGGCCTGAAGCTGTGTA-3′; IRF7, sense, 5′-GGGCTGCAGTGGCTGAACGA-3′, and antisense, 5′-GCAGGTTAACTCCACTAGGT-3′; Mx1, sense, 5′-CAACTGGAATCCTCCTGGAA-3′, and antisense, 5′-GGCTCTCCTCAGAGGTATCA-3′; IFN-β, sense, 5′-AGATGTCCTCAACTGCTCTC-3′, and antisense, 5′-AGATTCACTACCAGTCCCAG-3′; IL-6, sense, 5′-ACAGAAGGAGTGGCTAAGGA-3′, and antisense, 5′-CGCACTAGGTTTGCCGAGTA-3′; TNF-α, sense, 5′-TCACTGGAGCCTCGAATGTC-3′, and antisense, 5′-GTGAGGAAGGCTGTGCATTG-3′; α-tubulin, sense, 5′-TGCCTTTGTGCACTGGTATG-3′, and antisense, 5′-CTGGAGCAGTTTGACGACAC-3′; rps11 sense, 5′-CGTGACGAAGATGAAGATGC-3′, and antisense, 5′-GCACATTGAATCGCACGTC-3′. Cytokine mRNA is not degraded during cotreatment of wild-type HSV-infected cells with TLR agonists.Initially, we addressed the impact of the potential vhs RNase function in the repression of DC activation during HSV-1 infection. We have previously reported that coinfection of HSV-infected cells with RNA viruses (SeV and NDV) resulted in a significant vhs-dependent block to cytokine secretion (7). In contrast, when HSV-1-infected cells were treated with TLR agonists, the presence or absence of the vhs protein had no effect on the accumulation of proinflammatory cytokines in the supernatants (7), suggesting that mRNA for these cytokines is not a target for the nuclease activity of vhs. We began this study by utilizing this coinfection model of HSV-1 infection and directly measured the mRNA levels for proinflammatory cytokines and type I IFN. We infected BM-DCs with wild-type HSV-1 and then immediately added LPS, CpG, or NDV to the cells. The transcription of cytokines and type I IFN was measured by qRT-PCR (Fig.

1). We compared this level of mRNA expression to the level induced when the DCs were solely treated with either the TLR agonists or NDV (gray bars). Consistent with our previous findings looking at protein secretion, the mRNA expression for proinflammatory genes was not significantly altered during TLR agonist treatment of HSV-infected cells (compared to TLR treatment alone). We did, however, observe a significant decrease in IFN-β and cytokine mRNA expression during coinfection of HSV with NDV. These results highlight the sensitivity of the qRT-PCR assay to detect changes in cytokine and IFN-β mRNA expression. Moreover, these findings demonstrate that these select mRNA transcripts are not universally targeted for degradation by vhs and suggest that vhs may act by an as yet undescribed mechanism to inhibit DC activation. Based on the ability of wild-type HSV-1 to block NDV-induced proinflammatory cytokine mRNA expression, we next systematically evaluated what role known cellular signaling pathways critical for DC activation in response to NDV play during HSV-1 infection.

Thus, intracellular signaling through this pathway used by IL-6 family members (CNTF, leukemia inhibitory factor, OSM, and IL-11) may not play a primary role in modulating HSV replication. BM-DCs were generated from C57BL/6 mice and infected with wild-type HSV (KOS) at an MOI of 5 and then immediately treated with LPS (300 ng/ml), CpG (6 μg/ml), or NDV (MOI = 1.5). mRNA expression for IFN-β, IL-6, and TNF-α was measured by qRT-PCR at 6 h p.i. (black bars). We generated BM-derived DCs from MAVS KO mice and infected them with SeV, NDV, and wild-type HSV-1. The error bars represent the differences between triplicate assays. 1⇓, C and D).

This result reinforces the significance of negative charged molecules in HSV-1 entry. These receptors recognize the RNA of these viruses and signal through the mitochondrial adaptor protein MAVS to activate downstream transcription factors necessary for the expression of proinflammatory cytokines and IFNs. Based on the capacity for HSV to interfere with the activation of DCs in response to RNA virus infection (NDV and SeV [Fig. 1 and reference 7]), we investigated the role of MAVS in the DC response to HSV. We generated BM-derived DCs from MAVS KO mice and infected them with SeV, NDV, and wild-type HSV-1. In contrast to SeV and NDV, HSV-1 could induce the expression of cytokines and type I IFN independently of MAVS (Fig. GG-NER is not active in neurons, but they are fully capable of mounting a TC-NER response (Nouspikel and Hanawalt, 2000; Nouspikel and Hanawalt, 2002; van der Wees et al, 2007).

Further, when we compared wild-type HSV-1 to the vhs− mutant virus, which fails to incorporate the mutated vhs polypeptide into virion particles (45), we observed enhanced cytokine production for the vhs− mutant in both wild-type DCs and MAVS KO DCs (Fig. 2B). The data shown in Fig. 2 eliminate MAVS and, by extension, the RLR signaling pathway as critical for the activated DC phenotype observed during in vitro wild-type HSV or vhs− virus infection. The HSV-1 vhs protein modulates an RLR-independent pathway to proinflammatory release during HSV-1 infection. (A) BM-DCs were generated from C57BL/6 control and MAVS KO mice and infected with wild-type HSV (KOS) (MOI = 5), SeV (MOI = 1.5), and NDV (MOI = 1.5). mRNA expression for IFN-β, IL-6, and TNF-α was measured by qRT-PCR at 6 h p.i.

The error bars represent the differences between triplicate assays. (B) At 24 h p.i., control and (MAVS) IPS-1 KO DCs infected with KOS and vhs− viruses at an MOI of 5 were harvested, and the levels of IL-6 and IL-12p40 were measured from infected cell supernatants by ELISA. The error bars represent the differences between duplicate assays. vhs blocks a pathway to proinflammatory cytokine release independently of type I IFN signaling.vhs has been reported to negatively regulate the type I IFN signaling pathway by blocking the phosphorylation of STAT1, as well as interfering with the expression of ISGs (10, 27, 41). These prior observations led us to hypothesize that, through its potential inhibition of type I IFN signaling, vhs might exert its block to the activation of DCs observed during HSV infection. This would also explain the phenotype observed during HSV-1 coinfection with NDV (Fig. 1), as type I IFN signaling is required for this RNA virus to trigger DC activation (18, 67, 68).

Moreover, the presence of elevated secretion of IFN-α/β in the vhs− mutant-infected DC cultures compared to wild-type-infected DC cultures (Fig. 3A) would fit with a model where inhibition of type I IFN signaling by vhs impairs the amplification phase of type I IFNs. (Fig. (A) BM-DCs were generated from C57BL/6 mice and infected with the following: wild-type HSV-1 (strain KOS) (MOI = 5), vhs− mutant virus (MOI = 5), and SeV-HD (strain Cantel) (MOI = 5). At 6 h p.i., cells were harvested, and the quantities of IFN-β and IFN-α in the supernatants were measured by ELISA. The error bars represent the differences between duplicate assays. (B) At 12 h p.i., RNA was extracted from infected cells, reverse transcribed, and assayed for IFN-λ (IL-28a) by qRT-PCR.

The error bars represent the differences between triplicate assays. 1⇑), human PDC are known to secrete large quantities of type I IFN in response to viral stimulation (7). Recent developments in nanotechnology offer opportunities to re-explore biological properties of known antimicrobial compounds by manipulation of their sizes (Travan et al., 2010). The error bars represent the differences between duplicate assays. (D) At 6 h p.i., RNA was extracted from infected cells, reverse transcribed, and assayed for IRF7 and Mx1 by qRT-PCR. The error bars represent the differences between triplicate assays. (E) At 24 h p.i., infected cells were assayed for cell surface expression of CD86, CD80, and MHC II by flow cytometry.

(F) BM-DCs were generated from Sv129, IFNR KO, and STAT1 KO mice and infected with the following: UV-inactivated KOS and vhs− viruses at an MOI of 5. At 12 h p.i., IL-6 was measured by ELISA. The error bars represent the differences between duplicate assays. *, P < 0.05; **, P < 0.005. NI, not infected. To evaluate the role of IFN signaling in HSV-1-induced DC activation, we infected BM-derived DCs generated from mice genetically deficient in the type I IFN receptor (IFNR KO mice). As a control, confirmation of this deficiency is shown in Fig. 3D by the failure of these cells to induce expression of the IRF7 and Mx1 ISGs following virus infection. As shown in Fig. 3C, the production of cytokines associated with DC activation was robustly induced in the vhs−-infected IFNR KO DC cultures to levels similar to that observed in control B6 BM-DCs. In contrast to the vhs− virus-infected cells, wild-type HSV infection required type I IFN signaling for the production of the same cytokines. Importantly, vhs exerted its inhibitory function in the absence of exogenous IFN signaling. We also measured the cell surface expression of costimulatory molecules (CD80 and CD86) and MHC II. In contrast to cytokines, all surface markers tested required type I IFN signaling during HSV infection (both wild-type and vhs− mutant viruses) for optimal expression (Fig. 3E). Finally, we investigated the role of virus replication in HSV-induced DC activation in the absence of type I IFN signaling. Upon infection of all WT and KO BM-DCs with UV-inactivated HSV, we observed once again that wild-type HSV requires signaling through the type I IFN receptor, whereas the vhs mutant virus does not (Fig. 3F). To detect any potential differences in the establishment of latency and the rate of in vitro reactivation, IL-6 KO and WT mice (survivors from the experiments in Fig. Moreover, activation of this initial DC response is also independent of virus replication.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Polyubiquitination marks proteins for degradation by the 26S proteasome and is carried out by a cascade of enzymes that includes ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s), and ubiquitin ligases (E3s). Mutations of cation-coordinating residues within AO7’s RING finger abolished ubiquitination, as did chelation of zinc. Protein compositions of wild-type and ICP0 null virions were similar, suggesting that the absence of ICP0 does not grossly impair virion assembly. We also show that a deletion mutant of glass containing only the DNA-binding domain can behave in a dominant-negative manner both in vivo and in a cell culture assay that measures transcriptional activation. Replicate cultures of HEL fibroblasts were infected with 10 pfu or HSV-1(F) or R7914 mutant virus per cell and either left untreated or treated with MG132 for 1 h before harvest at 9 h after infection. Like ICP0, ORF61p is a transcriptional activator of viral promoters (15, 24), enhances infectivity of viral DNA (15) and has E3 ubiquitin ligase activity (4), and its presence results in decreased levels of Sp100 (8, 10). We propose that NCp7 binds to the RNA via a direct interaction of one zinc-binding motif to stem-loop 1 followed by binding of the other zinc-binding motif to stem-loop 1, stem-loop 2, or the linker region of the second RNA molecule, forming a bridge between the two RNAs.

When cells become infected with a virus, some of the signals emanating from the cells inform the environment of the presence of an intruder. Receptors, responding to the emanating signals, attempt to curtail viral replication or induce the infected cells to commit suicide. While the Mild Herpes Penis at hoe herpes treatment Herpes virus it pushes fluids up and out creating a crust right before healing. In the case of herpes simplex virus 1 (HSV-1), clear examples of interference with signaling are evidence that the virus blocks the presentation of antigenic peptides on the cell surface by major histocompatibility complex class I and II proteins (12, 16, 24, 27, 30). More recent studies indicate that interference with signaling is more pervasive. HSV-1 blocks exogenous interferon from affecting viral replication through degradation of the promyelocytic leukemia protein, the organizer of ND10 nuclear structure, which appears to regulate interferon response genes (3, 5), the acceleration of turnover of JAK1 (33), and degradation of IRF3 (22). At least one HSV-1 product, infected-cell protein 0 (ICP0), has been shown to down regulate the receptor tyrosine kinases using epidermal growth factors as prototypic receptors (19).

Given this background, it was of interest to determine the fate of the receptors of tumor necrosis factor alpha (TNF-α). TNF-α is secreted by a variety of cells, including natural killer cells, T lymphocytes, macrophages, etc. In turn, TNF-α induces a wide variety of genes that play significant roles in immune and inflammatory responses. It has been shown that ICP0 induces the proteasome-dependent degradation of two major components of ND10, PML itself and Sp100, particularly their isoforms that are covalently modified by the ubiquitin-like protein SUMO-1 (1, 8, 31, 33). TNF-R1 is expressed in most tissues, whereas TNF-R2 is typically found in cells of the immune system. The receptors share sequences in their ectodomains but differ with respect to cytoplasmic domains. Like the Skp1/Cdc53/cullin/F box (SCF) E3 complex, which functions in the G1 to S transition, the APC contains a cullin-like subunit, Apc2p (Yu et al., 1998 ; Zachariae et al., 1998 ; Kramer et al., 1998 ) and a small, RING-H2 finger subunit, Apc11p (Zachariae et al., 1998 ; Ohta et al., 1999 ; Tan et al., 1999 ; Kamura et al., 1999a ; Seol et al., 1999 ).

Saccharomyces cerevisiae HF7c was transfected with pGBT9-UbcH5B followed by 300 μg of pACT mouse T cell lymphoma library cDNA (CLONTECH). The disruption of ND10 structures is thought to facilitate HSV gene expression (6, 37). A central goal of the studies described in this report was to determine the fate of the TNF-R1 receptors present on the surface of several cell lines. E1 ubiquitin-activating enzymes are shown in dark blue, E2 ubiquitin-conjugating enzymes in green, RING finger subunits and domains in yellow, substrate-binding subunits and domains in magenta, and substrates in gray. ). Replicate HEp-2 cells were mock infected or exposed to 10 PFU of HSV-1(F) per cell and incubated for 6 h at 37°C. To prepare total cell lysates, the cells were harvested by scraping into lysis buffer (1% NP-40, 0.5% sodium deoxycholate, 150 mM NaCl) followed by brief sonication.

The proteins were denatured by boiling in sodium dodecyl sulfate (SDS) sample buffer for 5 min and subjected to electrophoresis on a denaturing polyacrylamide gel. If pictures of wrestling herpes have any sores, blisters, or red areas on your genitals your health care provider should examine you. 21335; Pierce) per ml at 4°C for 30 min and then rinsed three times with 100 mM glycine in PBS to quench and remove the biotin reagent. The cells were then harvested and lysed by scraping into binding buffer (0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate, fresh protease inhibitor) at 4°C, followed by brief sonication. Immobilized streptavidin agarose beads (no. 53117; Pierce) were rinsed in binding buffer twice and reacted with the lysate overnight at 4°C. The streptavidin-bound complex was collected and rinsed five times with binding buffer.

The biotinylated proteins were eluted from the beads with 8 M guanidine HCl. Both total and extracted cell surface proteins were electrophoretically separated on a 10% denaturing polyacrylamide gel, transferred to a nitrocellulose sheet, and reacted with anti-TNF-R1 antibody. Plasmid pEGFP-110wt expresses full-length ICP0 as a green fluorescent protein (GFP) fusion protein from vector pEGFP-C1 (26). 1A, both total and cell surface amounts decreased drastically after infection. The decrease in the amount of TNF-R1 on the surface of infected cells mirrored the decrease in the total amount of TNF-R1 accumulating in mock-infected and infected cells. To evict shuffle plasmid pAP33, transformants were replica-plated twice to complete media containing 1 mg/ml 5FOA, with 2 days of growth at 25°C between replicas. GST-Nedd4 and GST-E6AP have been described (9).

Cohen. ΔICP0 lacks the gene encoding ICP0, and ΔR-F carries amino acid substitutions (C116G/C156A) that disable the RING finger domain of ICP0 (18, 20). ΔUL41 contains the coding sequences of β-galactosidase inserted into the UL41 open reading frame (26). These data suggest that diffuse nuclear staining of ORF61p results from proteasome-mediated degradation, and this process requires an intact RING finger domain. As shown in Fig. 1B, TNF-R1 protein significantly decreased or virtually disappeared from cells at 2 h after infection with all viruses but ΔUL41. In ΔUL41-infected cells, the amount of TNF-R1 protein decreased, but not nearly as rapidly as in cells infected with wild-type virus.

American Society for MicrobiologyJournal of Virology
Thus, at 8 h after infection the amount of TNF-R1 protein in lysates of ΔUL41-infected cells was higher than that in wild-type-virus-infected cells harvested at 2 h after infection. The objective of the third series of experiments was to determine whether the rapid disappearance of TNF-R1 was UL41 dependent in other cell lines. In this series of experiments, replicate cultures of HEp-2 cells, U2OS, or HeLa cells were mock infected or exposed to 10 PFU of HSV-1(F), ΔICP0, ΔR-F, ΔUL41 or d120 per cell. Mutant virus d120 lacks the gene encoding ICP4 (7). The cells were harvested at 6 h after infection, processed as above, and reacted with anti-TNF-R1 antibody. In each cell line tested, TNF-R1 decayed in cells exposed to wild-type or mutant viruses except those exposed to ΔUL41 (Fig. 2).

In cells infected with this mutant virus, the amount of TNF-R1 decreased but were significantly higher than in other infected cell cultures. The beads were subsequently washed three times with 1 ml of buffer B (100 mM Tris-HCl [pH 8.0], 250 mM NaCl, 5% glycerol, 10 mM β-mercaptoethanol, 0.5% NP-40) and five times with 1 ml of buffer B containing 30 mM imidazole (pH 8.0) to remove nonspecifically bound proteins. The objective of the fourth series of experiments was to determine whether the life spans of TNF-R1 in mock-infected and infected cells were similar. In essence, the question posed was whether TNF-R1 was actively degraded in infected cells in contradistinction to its fate in uninfected cells. Triton X-100 was added to the lysates at a final concentration of 1% and left on ice for 20 min, before centrifugation at 10,000 rpm for 10 min (4°C). Transfections of and immunoprecipitations from COS cells were performed as described (9); 12CA5 (anti-HA; Roche Biomolecular Chemicals) was used for immunoprecipitations. Strain FXE virions did not contain ICP0 (Fig.

The salient feature of the results shown in Fig. 3 is that at 0.5 h after exposure to cycloheximide in either infected or mock-infected cells, the amount of TNF-R1 was less than half the amount present at the time of addition of the drug (0 h). For instance, the lowest-molecular-weight species detected with HA antibody was 70 kDa, and this corresponds to the slower-migrating more-abundant species of ORF61p detected with FLAG-specific antibody. The experiment did not elicit evidence that TNF-R1 protein was actively degraded in infected cells. The fundamental property of the virion host shutoff protein encoded by UL41 is that it acts as an endoribonuclease that selectively degrades mRNA (9, 29). If the disappearance of TNF-R1 protein was related to the nucleolytic activity of the UL41 protein, it would be expected that the TNF-R1 mRNA would be degraded in wild-type-virus-infected cells but not in mutant-virus-infected cells. In this series of experiments, replicate cultures of HeLa cells were mock infected or exposed to 5 PFU of HSV-1(F) or ΔUL41 virus per cell.

At 0, 1, 3, or 7 h after infection, cytoplasmic RNA was isolated, separated on a 1% agarose gel, and probed with 32P-labeled full-length TNF-R1 cDNA as described elsewhere (9). TNF-R1 fragment was amplified by RT-PCR of cytoplasmic RNA using primers TNFRSF1A forward0 (5′-CATGGGCCTCTCCACCGTGCCTG-3′) and TNFRSF1AB (5′-AGCCTCATCTGAGAAGACTGG-3′). Figure 4 shows a photograph of an ethidium bromide-stained gel of electrophoretically separated RNA: the rRNA serves as a loading control. The autoradiogram shown in Fig. 4 indicates that the mRNA encoding TNF-R rapidly decreased from wild-type-virus-infected cells but remained at a relatively stable level in cells infected with ΔUL41. These results are consistent with and support the hypothesis that UL41 protein acts by degrading the mRNA of TNF-R1. The fundamental conclusion of the studies presented in this report is that two factors account for the disappearance of TNF-R1.

Samples were examined using a Zeiss LSM 510 confocal microscope with three lasers giving excitation lines at 633, 543, and 488 nm. Therefore, steady-state levels of TNF-R1 require continuous replenishment by translation of its mRNA. In these studies we have shown that the mRNA levels decrease in a UL41-dependent manner. Immunofluorescence staining demonstrated that, for both mutants, >70% of the cells arrested with large buds, short mitotic spindles, and DAPI-staining masses at the bud-neck (Figure B). A GST fusion of a C-terminal truncation of AO7 at amino acid 363 (GST-AO7T) also was ubiquitinated (Fig. RING finger mutation causes ICP0 to be more readily retained in the nucleus at late time points in infection (36). HSV employs a large number of diverse strategies to inactivate host functions inimical to its replication and spread.

Some proteins are degraded by the action of E3 ligase activity of ICP0 (4, 6, 11, 14, 19, 21, 25, 31). Others are inactivated by phosphorylation by the viral protein kinases (2, 23, 28), by translocation into inoperative compartments of the cell (10, 13, 17, 34), or by recruitment to perform functions different from those expressed in uninfected cells (1, 15). In the case of TNF-R1, the strategy of HSV-1 is to take advantage of the short natural longevity of the protein. TNF-R1 downregulation in infected HEp-2 cells. (A) HEp-2 cells were mock infected or exposed to 10 PFU of HSV-1(F) per cell. The cells were harvested 6 h after infection and total cell lysate or extracted surface proteins were separated on 10% denaturing polyacrylamide gel, transferred to a nitrocellulose gel and reacted with anti-TNF-R1. (B) Time course of down regulation of total TNF-R1 in infected cells.

HEp-2 cells were mock infected or exposed to 5 PFU of HSV-1(F), ΔICP0, ICP0 RING finger mutant ΔR-F, or ΔUL41 per cell. Cells were harvested at 2, 4, and 8 h after infection. Total cell lysates were separated on 10% denaturing polyacrylamide gels and immunoblotted with anti-TNF-R1. A, cross-reacting cellular protein that served as a loading control. Downregulation of TNR-R1 is cell type independent. Replicate cultures of HEp-2, U2OS, or HeLa cells were mock infected or exposed to 10 PFU of the indicated virus per cell. Previous work had shown that ICP0-262 could be isolated as a monoubiquitinated form from transfected cells, due to conjugation of a single ubiquitin molecule to a lysine residue encoded by the intron sequences (41).

Half-life of TNF-R1 in infected HEp-2 cells. HEp-2 cells were mock infected or exposed to 10 PFU of HSV-1(F) or ΔUL41 per cell. Interestingly, mutating the corresponding residue (W408) in the c-Cbl RING finger lead to a reduction in its E3 activity (Joazeiro et al., 1999 ), suggesting that the tryptophan at this position plays a crucial role in the function of at least a small subset of RING finger proteins. The RING and positions of cysteines (C) are indicated. In contrast, a fraction of VP16 was readily removed by 1% Triton X-100, consistent with the presence of VP16 in the outer tegument (41, 43, 55). Northern blot of TNF-R1 in infected HeLa cells. HeLa cells were mock infected or exposed to 5 PFU of virus per cell.

Cells were harvested at 1, 3, or 7 h after infection, and cytoplasmic RNAs were extracted and separated on a 1% agarose gel followed by Northern blot analysis with 32P-labeled full-length TNF-R1 cDNA.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Sponsor ICD-10 Research Every month, more than 50,000 healthcare professionals use ICD-10 Research to perform more than 100,000 ICD-10 code lookups. Experimental models in five species, the mouse, rabbit, swine, cat, and ferret, were established with use of 10 viruses: Herpesvirus hominis types 1 and 2, murine cytomegalovirus, vaccinia virus, Shope fibroma virus, transmissible gastroenteritis virus, swine influenza virus, feline viral rhinotracheitis virus, feline panleukopenia virus, and ferret distemper virus. Links to PubMed are also available for Selected References. The virus preferentially infects CD4+T-lymphocytes and the surface marker CD46 acts as a co-receptor. In this case, we describe a patient with disseminated AIDS-associated KS lacking cutaneous manifestations. 15 Enteroviruses: Diagnosis Coexistence of rash and meningitis may be helpful but confusion with meningococcemia Meningitis lasts days to weeks CSF may contain a few polys initially but progresses to lymphocytes by 24 hours. A disseminated VZV infection which proved rapidly fatal was demonstrated in a case without skin manifestations.

KSHV activation of AP-1 leads to the transcriptional induction of interleukin 6 (IL-6), which is inhibited by inhibitors or dominant negative constructs of MAPK pathways. Together, these results demonstrate that KSHV induces AP-1 and IL-6 during primary infection by modulating multiple MAPK pathways. Because of the diverse roles of IL-6, AP-1, and MAPK pathways in viral infection and tumor induction and promotion, these results have important implications in the pathogenesis of KSHV-induced malignancies. Viral infection causes a deregulation of host cellular pathways, some of which reflect cellular responses to the infection while others are the results of viral manipulation of cellular environments (39, 49, 60). Sepsis statistics should become a standard component of federal statistical reports on public health, as well as of hospital statistics. For example, the modulation of mitogen-activated protein kinase (MAPK) pathways is essential for infection and replication of hepatitis B virus, Epstein-Barr virus (EBV), and vaccinia virus (15, 26, 70), while modulation of the NF-κB pathway facilitates infection and replication of EBV, herpes simplex virus type 1, and influenza virus (25, 46, 59). A 43-year-old man with AIDS developed septic shock and disseminated intravascular coagulation and died five days later.

Spontaneous resolution was not seen, and there was no trauma-induced bleeding. AP-1 complexes are ubiquitous heterodimeric transcriptional factors of Jun (c-Jun, JunB, and JunD) and Fos (c-Fos, FosB, Fra-1, and Fra-2) subfamilies. A chest radiography revealed multiple pulmonary nodules and the development of consolidation in both lungs. As the vaccine is engineered to express target antigens from the EID pathogen of interest, its spread from vaccinated to non-vaccinated animals will result in coordinated spread of EID-specific immunity throughout the targeted animal population. Herpes epithelial keratitis shows typical virus induced cytolysis of the superficial epithelium and is sensitive to antiviral drugs. Herpetic infections: Herpetic infections (including cold sores and herpetic keratitis) have been reported in IMLYGIC™-treated patients. AP-1 is also important for cellular transformation.

Both c-jun and c-fos themselves are cellular retroviral oncogenes (4). Some AP-1 members such as the Jun proteins can assist activated Ras in cellular transformation (61). The inclusion terms indicate some of the conditions for which that code number may be assigned. Treatment may include HLH therapy [7], which includes etoposide and corticosteroids. Besides its role in cell growth, cellular transformation, and induction of tumor formation, AP-1 is also involved in other aspects of tumor progression, such as invasion and angiogenesis, by regulating the expression of matrix metalloproteinases (MMPs) and angiogenic factors (14, 64). Kaposi’s sarcoma-associated herpesvirus (KSHV) is a gammaherpesvirus associated with Kaposi’s sarcoma (KS), primary effusion lymphoma (PEL), and multicentric Castleman’s disease (MCD) (20). In this study, we showed that maternal immunization with an HSV-2 replication-defective mutant mitigated against disseminated disease in newborn mice after a virulent oral challenge with a replication-competent TK-negative HSV-2 strain, but did not protect against spread of virus to the CNS.

American Society for MicrobiologyJournal of Virology
The early stage of KS is mostly seen on the skin of the lower extremities, but the advanced stage of KS is highly disseminated and often involved with visceral organs. A unique feature of KS tumors is that they are highly angiogenic and regularly contain infiltrated inflammatory cells (21). At necropsy, the animal was in slightly poor nutritional condition, with a body weight of 3.2 tons. Am J Transplant 2006; 6: 2365–2374. IL-6 is an autocrine growth factor for KS cells (19, 31, 41, 66) and a growth and survival factor for PEL cells (5). IL-6 is also important for the development of MCD in mice (54). While a recent microarray analysis has shown that KSHV infection induces the expression of IL-6, the mechanism of induction remains unclear (12, 45).

Considering the known biologic functions of AP-1 and the features of KS tumors, one can envisage the likely roles of AP-1 in various facets of KS pathogenesis, including malignant cellular proliferation, angiogenesis, induction of inflammatory cytokines, and dissemination of tumor cells. The expression of IL-6 is also regulated by AP-1 (16). His oxygen requirement further increased to 10 L/min via nonrebreather mask to achieve a saturation of 92%, and he was electively intubated. –10 10 particles per gram of PML brain. AP-1 activity can be regulated at multiple levels, including transcription, posttranslational modifications, protein turnover, and interactions with various cellular proteins. MAPK pathways, which have important roles in a broad spectrum of cellular functions, including cell proliferation, differentiation, survival, death, and gene expression, mediate AP-1 activation (35, 56, 65). MAPK pathways relay extracellular stimuli into the nucleus through a series of phosphorylation events that activate the upstream trimeric G proteins and downstream MAPK kinase kinases (MAPKKKs), MAPK kinases (MAPKKs), and MAPKs (32).

There are three groups of MAPKs in mammalian cells: the extracellular signal-related kinases (ERK1 and -2), the c-Jun NH2-terminal kinases (JNK1, -2, and -3), and the p38 kinases (p38α, p38β, p38γ, and p38δ) (13). Members of the ERK pathway, after translocation into the nucleus, directly phosphorylate c-Fos and ternary complex factors, which further bind and activate the fos promoter (30, 42). R57.2 is the code for septic shock, i.e., severe sepsis with hypotension despite adequate volume administration. The p38 pathway activates AP-1 by phosphorylating the transcriptional factors ATF2, MEF2C, and ternary complex factors (28). In Figure 2 their resemblance (arrowhead) to cytoplasmic processes of host cells is apparent. Integrin α3β1 was initially identified as a KSHV receptor; however, recent studies indicated that other cellular membrane proteins could also be involved in KSHV entry (55). Interactions of glycoprotein B with integrin α3β1 result in acute activation of the ERK1/2 pathway (44).

Therefore, it is reasonable to postulate that KSHV regulates AP-1 through activation of the ERK1/2 pathway, and possibly other MAPK pathways, during the early stage of infection. Consistent with epidemiological studies in humans, a major peak of infection occurs at an early host age, with essentially all US primate center rhesus macaques being RhCMV seropositive by the age of one year.[37] Environmental stresses, such as SIV infection of chimpanzees, can result in immune suppression of animals in the wild.[51] It will therefore also be important to ensure that any CMV-based vaccine presents no higher risk in immune-compromised animals than the wild-type CMV strains with which they are already infected. Thus, LANA and vFLIP are likely to modulate AP-1 during latent KSHV infection. No forward-looking statement can be guaranteed and actual results may differ materially from those we project. Both the vGPCR and vPK genes are lytic cycle genes and therefore can contribute to the activation of AP-1 during KSHV lytic replication. While the LAMP gene has been considered a latent gene, it is also induced by TPA (20). Thus, its gene class remains undefined.

Regardless of their gene classes, given that these genes are capable of activating MAPK pathways and AP-1, they are likely to induce the expression of IL-6. An autosomal dominant-negative mutation in tumor necrosis factor receptor–associated factor 3 (TRAF3) was identified in a child who presented at 4 years of age with HSE and recovered [15]. Using an efficient KSHV infection model of primary human umbilical vein endothelial cells (HUVEC) (24), we have found that KSHV activates AP-1 during the early stage of infection, which is mainly mediated by the virus entry events rather than the expression of KSHV genes. This is the first time that AP-1 activation by KSHV has been observed in the context of viral infection. Further studies are underway to explore this possibility. These results underscore some of the important molecular events of virus-cell interactions during the early stage of KSHV infection. Plasmids.The AP-1 reporter pAP-1-luc was purchased from Stratagene (La Jolla, CA).

antibody (Mab-WF-AF-1b; 1:200). 32 Tung BY, Farrell FJ, McCashland TM, Gish RG, Bacon BR, Keeffe EB, Kowdley KV. The following plasmids were described before: pcDNA3-p38/AF is a DN construct of p38 (29), HA-JNK[APF] is a DN construct of JNK (18), pCEP4L-HA-ERK1K71R is a DN construct of ERK1 (23), A-Fos is a DN construct of c-Fos (47), and pcDNA3 Flag-c-Fos expresses an active form of c-Fos (43). Cell culture.Human embryonic kidney 293 cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 100 μg/ml gentamicin, and 2 mM l-glutamine. Primary HUVEC were purchased commercially and cultured in EBM2 endothelial cell growth medium (Clonetics, Walkersville, MD).

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Deane, Race and Residential Mobility: Individual Determinants and Structural Constraints, 72 Soc. or to the blogs user Exclusive servers for faster access in peak times, for you and your visitors Reliable feed imports with shorter intervals! She couldn’t walk, but made the crawl by sunrise. intelligence officials interviewed by Greg Miller of the Los Angeles Times. K5 was transported to the cell surface and ubiquitinated pre-existing CD31, resulting in endocytosis and lysosomal degradation. For viruses that replicate in the nucleus, entry also entails extensive movement of viruses and viral capsids through the cytoplasm. These can be either modeled on viral proteins or derived from antimicrobial peptides.

M. Antiviral Res 67, 155-162. Earlier work has demonstrated the importance of considering the significance of any identified mediators in the pathogenesis of disease in the context of leucocyte subsets within the CNS [20]. 81:1062-1071, 2007). In this study, we showed that disruption of ORF57 in a KSHV genome led to increased accumulation of ORF50 and K8 pre-mRNAs and reduced expression of ORF50 and K-bZIP proteins but had no effect on latency-associated nuclear antigen (LANA). Cotransfection of ORF57 and K8β cDNA, which retains a suboptimal intron of K8 pre-mRNA due to alternative splicing, promoted RNA splicing of K8β and production of K8α (K-bZIP). BICP0 has recently been shown to associate with histone deacetylase 1 (57).

1, New England 75 Doubles; No. 4). Pizza itself was the chosen prop for the producers of yet another dubious “experiment” carried out with the intention of exposing something shitty about humanity and then lapping up the hits. You have someone to share the drunken commiserations with, and wipe the tears away when you fall down go boo boo. Stan: Why the hell can’t you just let this go?! A personalized treatment plan can be created from this list by identifying the underlying causes of CFS/FM, based on an analysis of the(a) patient’s particular symptoms. We also showed that reovirus was able to kill human medulloblastoma cell lines and tumor specimens in vitro and that intratumoral (i.t.) injection of reovirus in an orthotopic mouse model of human medulloblastoma significantly prolonged survival and reduced the frequency of metastases (12).

American Society for MicrobiologyJournal of Virology
The worst days of the week for dirty testers? G-I. The processing of these miRNAs is not dependent on the microprocessor complex. One possibility is that infections trigger epilepsy. In cells infected with wild-type HSV-1, the primary scaffolding protein is pre-VP22a (also called ICP35; product of the UL26.5 gene), although VP21, a cleavage product of the polypeptide encoded by UL26, can also serve effectively as a scaffolding protein (34). Then mediator data from each aetiological group underwent nearest neighbour analysis, using Pearson’s correlation coefficient, to generate proximity matrices (representing the strength of correlation between mediators)(SPSS 2011); from these, heat-maps were generated (SigmaPlot, Systat Software,USA), as described [17,25]. African green monkey kidney fibroblasts (Vero cells, ATCC CCL-81; American Type Culture Collection, Manassas, VA) were propagated in RPMI 1640 medium containing 10% FBS, gentamicin, and antimycotic-antibiotic solution (complete medium; Invitrogen, Carlsbad, CA) at 37°C, 5% CO2, and 95% humidity.

In particular, a gD-1 variant with a deletion in functional region IV, gD1(Δ290-299t), was able to bind to HveAt by ELISA and block virus entry 100-fold better than the wild-type protein, gD1(306t) (33, 50). Our recent studies showed that infecting cells with an ORF57-disrupted KSHV genome prevents the expression of K8α and K8.1 (33), two viral split genes with multiple introns and exons, thus indicating that KSHV ORF57 also regulates the expression of intron-containing viral genes. The presence of endogenous TK in mammalian cells facilitates investigations of DNA replication and repair. Cells and KSHV induction.A KSHV+/EBV+ B-cell line, JSC-1 (6), was maintained in RPMI 1640 medium. Human HEK-293 cells, HeLa cells, and stable Bac36 cells containing either a wild-type KSHV genome (Bac36-wt) or an ORF57-knockout KSHV genome (Bac36-Δ57) (33) were grown in Dulbecco’s modified Eagle’s medium. In Australia, participation in the programme is voluntary, flood control, storm damage prevention, prevention of pollution, protection of land containing shellfish, protection of fisheries and protection of wildlife habitat, as they relate to the Massachusetts Wetlands Protection Act and how are background check conducted running programs Medfield Wetlands Bylaw. To induce the expression of KSHV lytic genes, JSC-1 cells or stable Bac36 cells were cultured in the presence of sodium butyrate at a final concentration of 3 mM for 24 h or with valproic acid (VA) at a final concentration of 1 mM for 72 h.

Convinced, it bent its head and opened its beak. Recall also that Donald Rumsfeld was replaced as Defense Secretary because of his administration of the Iraqi war and human rights violations in torturing prisoners, state enemies, and suspected terrorists. IFA was performed as previously described.20 Images were captured with a Zeiss Axioskop 2 microscope and an AxioCam (Carl Zeiss, Göttingen, Germany). Eugeni Vaisberg, University of Colorado at Boulder; Vaisberg et al., 1993). Immunofluorescence staining.JSC-1 cells with or without butyrate induction were washed twice with phosphate-buffered saline, spotted onto polylysine-treated glass coverslips, and fixed with 4% paraformaldehyde. Stable Bac36 cells were grown on coverslips and induced with or without butyrate before fixation. Immunofluorescence staining was performed as described previously (33).

The predominant differences were between the infectious and immune-mediated groups and also between the unknown and the immune-mediated group. Louis, MO), antinucleophosmin (NPM/B23; Zymed Laboratories Inc, South San Francisco, CA), anti-K8 (Promab, Albany, CA), and anti-ORF50 antibodies were used, together with fluorescein isothiocyanate-conjugated anti-rabbit or tetramethyl rhodamine isothiocyanate-conjugated anti-mouse antibodies (Sigma). Confocal fluorescence images were collected using a Zeiss LSM510 META laser-scanning microscope equipped with a 63× Plan-Apochromat (numerical aperture, 1.4) oil immersion objective lens, with an optical slice thickness of 1.0 μm, an x-y pixel sampling of 0.1 μm, and a Z-step size of 0.2 μm. Individual optical slices were saved in TIFF format, and Adobe Photoshop 6.0 software (Adobe Systems, San Jose, CA) was used to process the images into composite figures. From 200 μl of this mixture, viral DNA was isolated by using the QIAamp DNA Mini kit (Qiagen) according to the manufacturer’s blood and body fluid spin protocol and then analyzed by real-time PCR (TaqMan; Applied Biosystems). Hepps, considered a landmark in constitutional and libel law. The HSV-1 protein ICP34.5 is dispensable for viral growth in non-neuronal culture cells, but it is required for the virus to replicate in the mouse CNS (10).

The proteins in the IP pull-downs were analyzed by Western blotting. The clutch position on the goddamn sports team will not just happen to be open when you, an untested eleven year old, wander onto the field. Can I be your second best buddy? On Doc’s examination, both ears were red and chronically thickened with “peau d’orange” and neither canal could admit even a newborn speculum. Two derivatives of myxoma virus (strain Lausanne), created by intergenic insertion of a marker cassette, were used for infection studies: vMyxgfp, which contains a green fluorescent protein (GFP) cassette driven by a synthetic vaccinia virus early/late promoter, and vMyxlac, which contains a β-galactosidase cassette driven by a late MV promoter. In vitro RNA splicing.In vitro splicing assays were carried out in a 12.5-μl reaction volume with 20 fmol of 32P-labeled pre-mRNA transcripts as described previously (37, 38, 72) in the presence of HeLa or HEK-293 nuclear extracts (NE) or cytoplasmic S100 with or without addition of SF2/ASF expressed in bacteria (75) or FLAG-tagged ORF57 expressed in baculovirus (34).

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Nobody likes getting the flu, but for some people, fluids and rest aren’t enough. Mutational analysis of AAV-2 capsid proteins showed that a group of basic amino acids (arginines 484, 487, 585, and 588 and lysine 532) contribute to heparin and HeLa cell binding. They are two different strains of the same virus, therefore it is possible to …contract one separately from the other. Random linker insertion mutagenesis of the fasA gene encoding the major 987P subunit identified five different mutants expressing wild-type levels of fimbriation. This caused infected cells to continue to produce harmless viral proteins that, in turn, caused the immune system to produce antibodies against the infection. Cold sores and genital herpes are very easy to pick up. Herpes simplex type 1, which is transmitted through oral secretions or sores on the skin, can be spread through kissing or sharing objects such as toothbrushes or eating utensils.

In addition to HSV types 1 and 2, the other identified herpes viruses are: Varicella Zoster Virus (VZV), the virus that causes Chicken pox, and also Shingles; Epstein-Barr virus (EBV), which causes infectious mononucleosis; Cytomegalovirus (CMV); and Human-Herpes Viruses (HHV) types 6 and 7. A: Hello, Yes herpes can cause pain like that if you have the lesion in a bad spot. 1, 2), the herpes simplex virus DNA polymerase of type 1 (HSV Pol)1 is an attractive model enzyme for studies of structural and functional organization of eukaryotic DNA polymerases (3). Since gH2Δ64/gL and gH2Δ72/gL were nonfunctional, we hypothesized that residues critical for gH/gL function lie within this deleted region. The data indicate that Ras-GAP phosphorylation by ICP10 PK is involved in the activation of the Ras/MEK/MAPK mitogenic pathway and c-Fos induction and stabilization. Because benzyl-α-GalNAc functions competitively, the weak binding of PILRα-Ig to benzyl-α-GalNAc-treated gB transfectants might have been due to an insufficient effect of benzyl-α-GalNAc on O-glycans. Therefore, the roles of Fas-FasL signaling in immune responses for host defense might vary depending on the pathogen.

Combining experimental data with a secondary structure prediction made by the PHD neural network method (32), based on a multiple sequence alignment of 19 alphaherpesvirus gB sequences, it was shown previously that no mutants with insertions in predicted α-helices or β-strands folded correctly (24). Drug resistance genes allow positive or negative selection, while fluorochrome (e.g. Recognition of gB by PILRα was abrogated almost completely by the treatment of gB transfectants with benzyl-α-GalNAc, whereas cell surface expression of gB was not affected. They can be spread when an infected person is producing and shedding the virus. The immense structural diversity of HSGAGs arises from the modification of individual disaccharide units within the oligosaccharide. Similarly, Western blot analysis showed that recognition of gB by PILRα-Ig was reduced by treatment with benzyl-α-GalNAc in a dose-dependent manner (Fig. Some of these limitations may have resulted from the fimbrial locations used for insertion, the target sites having been based exclusively on comparative and predictive analysis of primary structure information.

The molecular weight of gB expressed on cells treated with benzyl-α-GalNAc was slightly lower than that of gB on untreated cells. Thus, the presence of O-glycans on gB is critical for the interaction between PILRα and gB, as it is for the interaction between PILRα and CD99 (15). Herpes is a very common infection caused by a virus, called the herpes simplex virus, or HSV. Therefore you can infect yourself by having sexual relations with a person that is a asymptomatic carrier. I dont think so…….Unless by upper thigh you mean your babymaker. In the case of HSV Pol, mutational studies (30) as well as investigations carried out by limited proteolysis of HSV Pol (31) provided no evidence for a similar structural independence of 3′-5′-exonuclease and polymerase domains. (11) determined that residues near the C terminus of gH1 are important for its role in cell fusion and virus infectivity.

RR1 is expressed with apparently biphasic kinetics that consist of immediate-early (IE; also known as α) and early components (3, 30, 84, 86, 87, 90). Indeed, PILRα-Ig with this arginine residue mutated did not recognize gB or CD99 (data not shown). HSV-2 strain 186 was provided by Fred Rapp (Pennsylvania State University College of Medicine, Hershey, PA). Virus titers were subsequently determined on gB-expressing D6 cells. 2C: After several rounds of selection, progeny of mutant viruses are recovered from supernatant (not shown) or from infected cells in the case of cell-associated viruses such as MDV-1. Along with the result that O glycosylation on gB is important for association with PILRα, sialylated O-glycans on gB are involved in the interaction with PILRα. HSV-1 genital infections can result from either genital-genital contact or oral-genital contact with an infected person who is actively shedding virus.

Using information from the recently resolved atomic structure for the AAV-2 capsid (72), we can now describe a heparin-binding motif which is composed of basic amino acids and which is formed by folding into the threefold spike region of the capsid. The NetOGlyc 3.1 algorithm predicted seven threonine or serine residues (threonines at 37, 44, 53, 64, 67, and 480 and serine at 487) to be potential O glycosylation sites. The 5′ end of fasAof plasmid pDMS158 was removed as a SalI-SpeI fragment to obtain pDMS161. In order to analyze whether this N-terminal region is involved in recognition by PILRα, we constructed a gB chimeric molecule (gB30-115) possessing a BM-40 signal sequence (amino acid residues 1 to 40), a Flag-tag, an N-terminal gB fragment from its signal peptide cleavage site (amino acid residues 30 to 115) containing the five possible O glycosylation sites, and a transmembrane region of mouse PILRα (amino acid residues 196 to 256; GenBank accession number, NM_153510) to serve as an anchor to cellular membranes. This short N-terminal fragment of gB expressed on the cell surface was stained with both anti-Flag MAb and a PILRα-Ig fusion protein similar to wild-type (WT) gB (Fig. Symptoms may go away on their own without treatment in 1 to 2 weeks. NO more suffering of depression and low self-esteem.

A: The absolute best way to relieve STD itching is by visiting a doctor for help with treating and curing the symptoms of whatever it is that you have contracted. Enzyme storage buffer consisted of 20 mM Hepes/KOH, pH 7.5, 1 mM EDTA, 1 mM dithiothreitol, 40% (v/v) ethyleneglycol. Expanding upon these results, we found that gH2 mutants missing residues 19 to 63 (gH2Δ64) or 19 to 71 (gH2Δ72) also exhibited the permissive gH transport phenotype but were unable to function when coexpressed with gL. In experiments with the MEK inhibitor PD98059 (1, 56), cells were pretreated (1 h, 37°C) with 25 or 50 μM PD98059 and infected in medium containing the same drug concentration. Flag-tagged N terminus fragments of gB (amino acid residues 30 to 115) containing five potential O glycosylation sites or point mutations of these possible O glycosylation sites … IFN-γ in the culture supernatant was measured by using an enzyme-linked immunosorbent assay (ELISA) kit (R&D Systems, Minneapolis, MN). In the present study, two-amino-acid insertions were made in regions of the ectodomain identified as loops by a secondary structure prediction based on the PHD neural network procedure (Fig.

1993. This finding suggests that T53 is a dominant O glycosylation site on gB, which is involved in interactions with PILRα, although additional potential O glycosylation sites other than those near the N terminus might also be involved. This can put the person at higher risk for infection. Mutagenesis was performed by using a Stratagene (Amsterdam, The Netherlands) QuikChange site-directed mutagenesis kit according to the manufacturer’s protocol. None of these mutations affected the cell surface expression of gB. This cassette is a SmaI restriction fragment of pDMS183, which contains a Cmr gene flanked by overlappingSmaI/ApaI restriction sites (18). These data suggest that two O glycosylation sites of gB, T53 and T480, are involved in the association with PILRα.
American Society for MicrobiologyJournal of Virology

Both T53 and T480 are located in a proline-rich region, which may be important for protein folding (16). Herpes simplex viruses can involve the brain and its lining to cause encephalitis and meningitis. Therefore, we analyzed whether the point mutations of gB affected oligomer formation. Oh, and type 1 can become type 2. Recombinant plaques were screened by negative β-galactosidase expression (40), and high titer virus stock solutions were prepared after three cycles of plaque purification according to standard procedures (34). Spear. Detection was with enhanced chemiluminescence reagents (NEN) according to the manufacturer’s instructions.

As shown in Fig. In preliminary experiments, we inoculated HSV-2 strain 186 intravaginally to recapture the physiological infection process. . Journal of Virology, 32: 7888–7898. Because benzyl-α-GalNAc treatment inhibits synthesis of all the O-glycans on gB, other O glycosylation sites on gB might exist. RESISTANCE in HSV is due to mutations in two different viral proteins:. The cells then were incubated with 100 μl of streptavidin-coupled peroxidase diluted to a final concentration of 0.8 μg/ml in blocking buffer/well for 1 h at room temperature.

In order to analyze O glycosylation on gB, we employed a novel method to label O-linked glycans, using Click-iT O-GalNAz metabolic glycoprotein-labeling reagent (azido-GalNAc) (Invitrogen). Plasmids of transformants carrying the insertions were identified by restriction analysis. gBs were immunoprecipitated with anti-gB MAb, and the azido-GalNAc incorporated into gB was treated with phosphine-Flag, which specifically reacts with the azido-GalNAc (11), followed by detection with anti-Flag MAb by Western blotting. WT gB, T53A-mutated gB, and T480A-mutated gB were blotted with anti-Flag MAb, whereas T53AT480A gB was only weakly blotted with anti-Flag MAb (Fig. It is best to refrain from any type of sex (vaginal, anal, or oral) during periods of active outbreak. In contrast, there was no significant difference in the total amount of gB expressed. This result suggests that T53 and T480 of gB are O glycosylated.

After resuspending in 5 ml of buffer A cell pellets were reextracted by ultrasonication as before, and the combined supernatants were passed through a 5-ml column of DEAE-cellulose (Whatman, Maidstone) equilibrated with buffer A. C10 cells were transfected using GenePORTER with plasmids encoding gL and either wild-type (WT) or mutant gH2. Extracts of cells (107) in lysis buffer (50 mM Tris-HCl [pH 7.5], 1% NP-40, 150 mM NaCl, 1 mM PMSF) were kept on ice for 15 min and clarified by centrifugation (30 min, 16,000 × g). However, weak detection of O-glycans on the T53AT480A gB suggest the presence of O glycosylation sites other than T53 and T480 on gB. *, P < 0.01, log rank ... . 1998. 1B) could have been necessary for the binding of PILRα-Ig to the blots. Thus, the binding of PILRα might depend upon the close proximity of the O-glycans attached to T53 and T480 in the trimeric conformation of gB. Female immunocompetent NMRI mice (6 to 8 weeks old) were purchased from the German branch of Charles River Laboratories (Wilmington, Mass.). Requirement of sialylated O-glycans on gB for the interaction with PILRα. The DL6 or 1D3 MAb recognizing HSV gD epitopes (20, 29) inserted into FasA was used at a 1:2,000 dilution, and the secondary antimouse antibodies conjugated to horseradish peroxidase were used at a 1:5,000 dilution in blocking buffer. As a control, the transfectants were stained with control Ig or control MAb (dotted line). Histograms show fluorescence intensity measured in arbitrary units on a log scale (x axis) and relative cell number on a linear scale (y axis). (B) Total cell lysates of mock (M)- or gB-transfected 293T cells treated with benzyl-α-GalNAc at the indicated concentrations were separated by SDS-PAGE, followed by blotting with anti-gB antiserum (R74; see reference 2) or PILRα-Ig. (C) gB (left)- or gD (right)-transfected 293T cells were incubated in the presence or absence of sialidase (0.01 U/ml) for 3 h and were stained with PILRα-Ig (solid line), nectin-Ig (solid line), or control Ig (dotted line). Expression of gB or gD was analyzed by using anti-gB MAb (solid line), anti-gD MAb (solid line), or control MAb (dotted line). 3′-End-labeled primers were synthesized in reaction mixtures (20 μl) containing 7 μg of oligonucleotide, 1 μCi of [α-32P]dTTP (3000 Ci/mmol), 30 units of terminal deoxynucleotidyltransferase, and 1 × One-Phor-All buffer, as specified by the supplier (Biotech Pharmacia, Freiburg), for 10 min at 37°C. At 24 h postinfection, cells were freeze-thawed and virus was collected from the culture medium. The supernatants were spotted onto PEI plates and chromatographed in 0.75 M KH2PO4 (pH 3.4). The transfectants were stained with control Ig (dotted line) or PILRα-Ig (solid line). The percentages of CD4+, CD8+, and CD4− CD8− cells in CD3+ T cells in the spinal cord (A) and spleen ... Of the 10 mutants with reduced activity in both functional assays, the remaining candidates were therefore 331AS332, 376AS377, and 655AS656. In R.F. (A) 293T cells were transfected with various mutated gBs, and the transfectants were stained with control Ig (dotted line) or PILRα-Ig (solid line). Expression of gB was analyzed by staining with anti-gB MAb (solid line) or control MAb (dotted line). The three-dimensional structure of the AAV-2 capsid was determined (our own software) with the BIOMT information given in the Brookhaven Protein Data Bank file. (B) Membrane proteins prepared from COS-7 cells transfected with WT gB and mutated gBs were boiled or left unheated in SDS sample buffer in reducing or nonreducing conditions, respectively. Antibody titers of approximately 1/50,000 were determined by enzyme-linked immunosorbent assay, as described previously (52), using coated peptide antigen. Analysis of O-glycans on WT and mutated gB. O-glycans on gB expressed on 293T cells were metabolically labeled with Ac4GalNAz and were then immunoprecipitated with anti-gB MAb. The labeled O-glycans in immunoprecipitates were modified with phosphine-Flag and were then analyzed by Western blotting. The labeled O-glycans and total amount of gB were detected by anti-Flag or anti-gB MAb, respectively. This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan (Y.K. Aliquots (5 μl) of each reaction mixture were boiled briefly, chilled rapidly, and then subjected to electrophoresis on 12% DNA sequencing gels, containing 8 M urea (46). ). Vero cells were pretreated (1 h, 37°C) with 50 μM MEK inhibitor PD98059 (Calbiochem, LaJolla, Calif.) or were mock treated with reconstitution solution free of PD98059 and then infected with HSV-2 in the presence or absence of PD98059. is an American Cancer Society Research Professor.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Biotech startup Theranos notched a regulatory win last week after the Food and Drug Administration (FDA) cleared a new test and analysis system for finding the herpes simplex 1 virus with a single finger prick of blood. Suazo et al. Of potential relevance are a FCGR3A dimorphism resulting in CD16A-valine/phenylalanine-158 allotypes with different IgG affinity, variations conditioning NK cell expression of CD32B or CD32C, and IgG1 H chain (IGHG1) and kappa-chain (IGKC) polymorphisms determining allotypes designated G1m and Km. It is no surprise that herpesviruses encode, among many other immune evasion factors, gene products that target antigen presentation by major histocompatibility complex class I (MHC-I) [1]. Interferon γ-inducible protein 16 (IFI16) and cGMP-AMP synthase (cGAS) have both been proposed to detect herpesviral DNA directly in herpes simplex virus (HSV)-infected cells and initiate interferon regulatory factor-3 signaling, but it has been unclear how two DNA sensors could both be required for this response. Most of the hospitalizations (68%) involved subjects > 65 years; the mean length of stay was 9.5 days. Results IDO1 was strongly expressed in HCEn cells after HSV-1 infection.
American Society for MicrobiologyJournal of Virology

In contrast, effector CD8+ T cells from SYMP individuals were mostly monofunctional and were directed mainly against nonoverlapping gB17–25 and gB183–191 “SYMP” epitopes. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. Understanding of the precise mechanism of viral modulation of CD1d expression will help to develop more efficient vaccines in the future to boost host NKT cell-mediated immune responses against herpesviruses. IMPORTANCE In this study, we have obtained data suggesting that (i) the HSV-1 major virion structural protein UL47 interacted with host cell protein p32 and mediated the recruitment of p32 to the nuclear rim in HSV-1-infected cells; (ii) p32 was a component of the HSV-1 nuclear egress complex (NEC), whose core components were UL31 and UL34; and (iii) p32 regulated HSV-1 de-envelopment during viral nuclear egress. Immunization with “ASYMP” CD8+ TEM cell epitopes, but not with “SYMP” CD8+ TCM cell epitopes, induced a strong protective HSV-specific CD8+ T cell response in HLA-A*02:01 transgenic mice. These findings are important for the development of a safe and effective T cell-based herpes vaccine. Citation Khan AA, Srivastava R, Spencer D, Garg S, Fremgen D, Vahed H, Lopes PP, Pham TT, Hewett C, Kuang J, Ong N, Huang L, Scarfone VM, Nesburn AB, Wechsler SL, BenMohamed L.

M.M. Our investigation resulted in identification of a poorly understood protein equivalent to the HSV-1 (Herpes simplex virus 1) pUL43 homologue that is also involved in the inhibition of the presence of MHC-I molecules on the cell surface. wrote the paper. doi:10.1128/JVI.03419-14.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

The Herpesviridae are a large family of enveloped, double-stranded DNA viruses that are responsible for many human and veterinary diseases. Structural and genetic relatedness led to the classification of this virus as a member of the genusRhadinovirus. This motor is composed of the large subunit whose ATPase activity fuels DNA translocation, and most frequently, a small subunit that binds to the viral packaging site. Furthermore, no large repetitive DNA sequences could be identified. All are large, enveloped viruses, consisting of a linear double-stranded DNA genome, ranging from approx 120 kbp-230 kbp in size. In the case of trypsin-treated capsids, DNA release was found to correlate with cleavage of a small proportion of the portal protein, UL6, suggesting UL6 cleavage may be involved in making the capsid permissive for DNA ejection. The sequence of the KHV genome revealed a significant number of original DNA sequences with no homology to any other known viral sequences.
American Society for MicrobiologyJournal of Virology

Canine herpesvirus (CHV; species Canid herpesvirus 1) was first described in 1965 as the causative agent of a fatal haemorrhagic disease of puppies [1]. No other herpesvirus sequenced to date contains a homologue of this gene. In contrast, the m1 form was detected in none of the organs tested, suggesting its potential as the basis of an attenuated vaccine candidate. Our findings represent a major step towards characterizing TeHV-3 and developing prophylactic methods against it. IMPORTANCE Testudinid herpesvirus 3 (TeHV-3) causes a lethal disease in tortoises, several species of which are endangered. We have characterized the viral genome, and used this information to take steps towards developing an attenuated vaccine. We have sequenced the genomes of two strains (1976 and 4295), compared their growth in vitro, and investigated the pathogenesis of strain 4295, which consists of three deletion mutants.

The major findings are: (i) TeHV-3 has a novel genome structure; (ii) its closest relative is a turtle herpesvirus; (iii) it contains interleukin-10 and semaphorin genes, the first time these have been reported in an alphaherpesvirus; (iv) a sizeable region of the genome is not required for viral replication in vitro or virulence in vivo; and (v) one of the components of strain 4295, which has a deletion of 22.4 kb, exhibits properties indicating that it may serve as the starting point for an attenuated vaccine.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

BioVex Inc, a private biotechnology company developing new generation biologics for the treatment of cancer and prevention of infectious disease, announced that the first subject had been dosed in the Phase 1 study of its live attenuated genital herpes vaccine, ImmunoVEXHSV2. Researchers at Albert Einstein College of Medicine in New York City report that the vaccine was safe and effective in protecting mice against herpes simplex virus type 2 (HSV-2), the virus that causes genital herpes. Cold sores are linked to HSV1, and genital herpes is linked to HSV2. Healthy girls aged 10–17 years, stratified by age (10–15 years; 16–17 years), were randomised 2:1:1 to receive the HSV vaccine, a hepatitis A vaccine (Havrix™; HAV control) or placebo (saline) according to a 0-, 1-, 6-month schedule. Immunization with gC2/gD2 produced potent neutralizing antibodies, while UL19 and UL47 also stimulated antibody responses. After intravaginal HSV-2 challenge, the mock and UL19/UL47 adenovirus groups developed severe acute disease, while 2/8 animals in the gC2/gD2-only group and none in the combined group developed acute disease. ImmunoVEX is a rationally designed live attenuated vaccine specifically constructed to address the limitations of previous vaccines.
American Society for MicrobiologyJournal of Virology

Lumbosacral dorsal root ganglia were positive for HSV-2 DNA and latency-associated transcripts for 5/8 animals in the gC2/gD2 group and 2/8 animals in the combined group. The glycoproteins in Africans who have HSV may have different genetic strains than the patients in Europe and the U.S. The HSV vaccine was immunogenic regardless of pre-vaccination HSV serostatus. IMPORTANCE HSV-2 infection is a common cause of genital ulcer disease and a significant public health concern. Genital herpes increases the risk of transmission and acquisition of HIV-1 infection 3- to 4-fold. A herpes vaccine that prevents genital lesions and asymptomatic genital shedding will have a substantial impact on two epidemics, i.e., both the HSV-2 and HIV-1 epidemics. We previously reported that a vaccine containing HSV-2 glycoprotein C (gC2) and glycoprotein D (gD2) reduced genital lesions and asymptomatic HSV-2 genital shedding in guinea pigs, yet the protection was not complete.

We evaluated whether adding the T cell immunogens UL19 (capsid protein VP5) and UL47 (tegument protein VP13/14) would enhance the protection provided by the gC2/gD2 vaccine, which produces potent antibody responses. Here we report the efficacy of a combination vaccine containing gC2/gD2 and UL19/UL47 for prevention of genital disease, vaginal shedding of HSV-2 DNA, and latent infection of dorsal root ganglia in guinea pigs. Citation Awasthi S, Mahairas GG, Shaw CE, Huang M-L, Koelle DM, Posavad C, Corey L, Friedman HM. 2015. A dual-modality herpes simplex virus 2 vaccine for preventing genital herpes by using glycoprotein C and D subunit antigens to induce potent antibody responses and adenovirus vectors containing capsid and tegument proteins as T cell immunogens. J Virol 89:8497–8509. doi:10.1128/JVI.01089-15.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Latent membrane protein 1 (LMP1) of Epstein-Barr virus (EBV) is a transforming protein that affects multiple cell signaling pathways and contributes to EBV-associated oncogenesis. Here, we describe a novel interaction between LANA2 and both the phosphoserine/phosphothreonine-binding 14-3-3 proteins and the transcription factor FOXO3a. Some viruses employ the process of epithelial differentiation for productive viral replication. IκB phosphorylation inhibitor (Bay11-7082) reduced this activation significantly. We found that the transcription factor Ets-1 is highly expressed in KS spindle cells and is upregulated during KSHV infection of endothelial cells in culture. Furthermore, Tip contains a putative consensus YXPQ binding motif for the SH2 (src homology 2) domains of STAT1 and STAT3. Kaposi’s sarcoma (KS) is a complex angioproliferative lesion that is the most common neoplasm in patients with untreated AIDS, though it also exists in a human immunodeficiency virus-independent form.

Biochemical and genetic experiments identified RelA as a key player downstream of IKKβ and IKKε. The mechanism through which STAT6 is modulated by KSHV remains unclear. In parallel, we also repaired the mutation and obtained a revertant, BAC16-45A66F. M., Walker, J. The histogenesis of spindle cells has long been debated. The investigators also note that herpesvirus activation has been associated with poor outcomes following bone marrow transplantation. Subsequent to the acute phase of the response, MHV-68 infection produces a syndrome similar to EBV-induced infectious mononucleosis in humans.

In this study, we report the generation of a TCR transgenic (tg) mouse with specificity for the γHV68 gp15067–83 epitope. For instance, KS tumors are never observed in tissues (e.g., brain) that are devoid of lymphatics (47). While many established cells in culture can be latently infected by KSHV, most such cells display no phenotype (2). However, the pathogenetic significance of the latter observations has been rendered ambiguous by recent findings that KS-associated herpesvirus (KSHV) infection of lymphatic or vascular endothelial cells can reprogram their expression of endothelial markers (17, 45). Agency Res. Latently infected cells are detected at increased frequency in tissue, such as lymphoid tissue and the gastrointestinal (GI) tract.24 Virus can also persist in other long-lived cells such as infected macrophages,25 naïve T cells,26 follicular dendritic cells27 and the cells in the central nervous system (CNS) including astrocytes28 and microglia.29 The relative contribution of these non-memory T-cell reservoirs is less clear. HEK293T cells were transiently co-transfected with individual LTR-targeting sgRNAs or a nonspecific control sgRNA (sgCTRL), dCas9-VP64 or dCas9-VP160 and the pNL4-3.Luc.R-E- reporter plasmid.

Overexpression of spliced XBP-1, or its artificial induction with dithiothreitol (DTT), leads to reactivation of KSHV in PEL cells in vitro (18–21). The KSHV ARP is characterized by an absence of a requirement for the replication and transcription activator (RTA) protein, the product of open reading frame (ORF) 50, a protein that was previously believed to be essential for KSHV replication, an accelerated pattern of late gene expression, and the production of large amounts of virus with decreased infectivity. Recent studies have revealed that mutation of a conserved lysine residue within subdomain II abolishes phosphorylation; this finding shows that this region is necessary for the catalytic activity of these protein kinases (6, 7). During latency, KSHV expresses only a few viral latent genes, including latent nuclear antigen (LANA or LNA) encoded by ORF73, vFLIP encoded by ORF72, vCyclin encoded by ORF71, and more than two dozen microRNAs derived from 12 precursor microRNAs (1). HUVECs were cultured in VascuLife® VEGF cell culture medium (Lifeline Cell Technology). Virally encoded transactivator genes are repressed during latency, but when they are expressed, the transactivator proteins drive the lytic cycle. TLRs are a family of pattern-recognition receptors that play a central role in innate immunity (10).

American Society for MicrobiologyJournal of Virology
Thus, in addition to its widely recognized antiapoptotic functions, vFLIP also induces the development of cell-autonomous morphological changes and contributes to the inflammatory microenvironment, two features that have long been recognized as signatures of Kaposi’s sarcoma. Cells and KSHV infection.Human umbilical vein endothelial cells (HUVECs) were purchased from Clonetics and cultured in endothelial growth medium (EGM-2) supplemented with the microvascular supplement pack (Clonetics). These examples include the only patient known to have been cured of HIV-1 infection, and other patients that while not cured nevertheless experienced substantial reductions in the reservoir [39–42], although for these patients rebound viremia was observed 15 weeks after treatment interruption [43]. STAT3 is activated by a number of cytokines, including the IL-6 family of ligands. KSHV was concentrated from supernatants of induced BCBL-1 cells as previously described (2, 23). KSHV infections were performed in medium containing 2 μg/ml Polybrene and incubated with cells for 2 h, after which cells were rinsed and medium was added back. Retrovirus production and infection.Retroviruses were produced using the amphotropic Phoenix packaging cell line transfected with the Moloney murine leukemia virus-based vector pBMN (internal ribosome entry site puromycin resistance).

Phoenix cells were transfected using FuGENE 6 (Roche) according to the manufacturer’s specifications. The cells were broken by three quick successive cycles of freeze-thawing. Concentrated retroviruses were resuspended in EGM-2 with 6 μg/ml Polybrene and filtered through a 0.2-μm filter. Concentrated retrovirus was diluted in EGM-2 with 6 μg/ml Polybrene and applied to cells. These cultures were spun at 2,000 rpm for 1.5 h, after which virus-containing medium was removed and regular culture medium was added back. In cases were selection was employed, 24 h after transduction, medium containing the selective agent was added to cells at the stated concentration. Immunofluorescence, cytokine array, ELISA, and flow cytometric analyses.Immunofluorescence assays were performed as previously described using either polyclonal antibody to latency-associated nuclear antigen (LANA) (A.

Polson and D. The cells were harvested at the time of infection (0 h) and at the times shown in Fig. Wu and B. Forghani) or anti-p65 (Santa Cruz Biotechnology) (2). Secondary antibodies anti-rabbit and anti-mouse fluorescein isothiocyanate (FITC) and anti-mouse rhodamine (Santa Cruz Biotechnology) were used at 1:300. The administered viruses were the WT HSV-1(F) isolate or the recombinant virus R111 carrying within its WT genome the gene encoding human REST driven by the SV40 early promoter (1). Purified DNA was denatured in 0.3 M NaOH and treated with 5 M bisulfite/0.5 mM hydroquinone (pH 5.0) for 3 h at 55°C.

Arrays were performed with EGM-2 basal medium plus 2% fetal bovine serum conditioned by HUVECs for 24 h. Enzyme-linked immunosorbent assays (ELISAs) were performed according to the manufacturer’s instructions (BD Bioscience) using medium conditioned for 24 h. For flow cytometry, HUVECs were incubated with anti-VCAM-1 antibody at a 1:100 dilution (BD Pharmingen) for 30 min on ice. Allophycocyanin-conjugated goat anti-mouse secondary antibody (Caltag) was used at a 1:250 dilution also for 30 min on ice. Analysis was performed using a Becton Dickinson FACSCalibur. NF-κB electrophoretic mobility shift assay.Nuclear enriched lysates were made from cells by incubation with hypotonic buffer (20 mM HEPES [pH 7.8], 5 mM KCl, 1.5 mM MgCl2, 1 mM dithiothreitol, and protease inhibitors), followed by pelleting and disruption of nuclei by incubation in high-salt buffer (0.4 M KCl, 50 mM HEPES [pH 7.9], 0.1% NP-40, 0.5 μM EDTA, 10% glycerol, and protease inhibitors). A total of 5 μg of lysate was incubated with 32P-labeled oligonucleotide encoding the NF-κB consensus sequence (Santa Cruz Biotechnology) and dI:dC DNA (Sigma) in binding buffer (20 μM HEPES [pH 7.9], 50 mM KCl, 10% glycerol, 1 mM EDTA, 1 mM MgCl2, and 1 mM dithiothreitol).

In cases of competition, unlabeled wild-type or mutant oligonucleotides (Santa Cruz Biotechnology) were included in a 250-fold excess. For supershifting, 1.5 μl of anti-p65 (Santa Cruz Biotechnology) was included in the binding reaction. However, the promoters and cis-elements controlling these genes are in fact clustered in a relatively small region spanning the fused terminal repeats (TRs) of the viral episome (see Figure 1). Complexes were resolved in a 1× Tris-borate-EDTA-4% acrylamide gel. Luciferase assays.HUVECs were transduced with retroviruses encoding either vFLIP or empty vector and subjected to selection. Once the vFLIP-expressing cells had fully developed into spindle cells, the cells were transfected in OptiMEM medium (Gibco) with 0.6 μg NF-κB-luciferase vector and 0.4 μg β-galactosidase-encoding vector using 0.25 μl Jurkat transfection reagent (Mirus). The DNA transfection mixture was incubated on the cells for 4 h, after which the cells were rinsed and regular medium was added back.

After 48 h, luciferase and β-galactosidase assays were carried out according to the manufacturer’s specifications (Promega). Inhibition of NF-κB.HUVECs were treated with 4 μM Bay 11-7082 (Calbiochem) in dimethyl sulfoxide (DMSO) for 2 h before being transduced with vFLIP-encoding retrovirus as described above. Plasmid RpCAT contains the BRLF1 IE promoter (Rp) sequences (from –962 to +5 relative to the mRNA start site) linked to a heterologous reporter gene, CAT, in the pBS phagemid vector (Stratagene, La Jolla, CA) (29).

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

The immune system targets virus-infected cells by different means. It is a gammaherpesvirus that shows sequence homology to Epstein-Barr virus (EBV) and herpesvirus saimiri (HVS) that are able to transform B (EBV) and T cells (HVS), respectively. In this study, we identified a cysteine-rich domain (CRD), CDR2, of CD134 that is critical for binding to the HHV-6B glycoprotein complex and HHV-6B infection. We show here that SAUGI has differential inhibitory effects on UDGs from human, bacteria, Herpes simplex virus (HSV; human herpesvirus 1) and Epstein-Barr virus (EBV; human herpesvirus 4). In addition, both peptides are CXCR4 antagonists. However, during the course of several million years of coevolution with their hosts, certain viruses have developed defenses that involve immune evasion strategies targeting the complement system. This packaging process is performed by the terminase complex, which in HCMV includes at least, two proteins UL89 and UL56.

Eight herpesviruses have been implicated to date in the etiology of a number of human diseases. IE1B undergoes further post-translational modification with its conjugation to the small ubiquitin-like modifier (SUMO-1) peptide. KSHV can be directly cultured to high copy number in PEL-derived cell lines, yet the efficiency of transmission to other cell lines and serial propagation of the virus remain low (9, 21). Definitive studies of capsid assembly have been carried out in alphaherpesviruses and have been extended to include in vitro, cell free assembly of the herpes simplex viral (HSV) capsid (Newcomb et al., 1994). K. Structural studies on bacteriophage T4 L-terminase have revealed the organization of a prototypical L-terminase subunit (5, 6), thought to be conserved in other DNA viruses. Although determinants of viral cell tropism lie in each step of the virus life cycle in target cells, the differences in receptor preference of HHV-6A and -6B may contribute much to their cell tropism.

Along with herpes simplex virus-1 (HSV-1) — the prototypic alphaherpesvirus that causes cold sores, and human cytomegalovirus (HCMV) — a betaherpesvirus that is a leading cause of birth defects, gammaherpesviruses have a characteristic multilayered architecture. The KSHV ORF 4 is a 1,650-nucleotide ORF that encodes a protein with four SCRs. As a result of alternative splicing, the ORF 4 protein is thought to be expressed both as a membrane-bound 550-amino-acid protein with a putative transmembrane region at amino acids 517 to 545 and as a shorter secreted form that lacks the transmembrane region (11, 14). The sequence similarity between the ORF 4 protein and the human CCPs CR1, CR2, DAF, MCP, factor H, and C4bp varies from 44 to 55%. Although the ORF 4 protein is composed of tandemly repeating SCR domains with significant sequence similarity to human CCPs, this similarity by itself is not a sufficient criterion for assigning complement-inhibitory function to this protein. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. To determine whether the ORF 4 protein actually possesses complement-inhibitory activity, we have expressed the soluble form of this protein (SCRs 1 to 4 without the transmembrane region) using the Pichia expression system.

In particular, in designing the construct, we did not include the His tag that is normally added during protein expression to aid in purification, since addition of His residues might introduce a stretch of charge on the protein (if the pKa of His is altered upon binding) and thus influence its activity. In brief, the ORF 4 protein encompassing SCRs 1 to 4 was amplified from the HHV-8 clone CB43 (a kind gift of Jens-Christian Albrecht and Frank Neipel, Institut für Klinische und Molekulare Virologie, Erlangen, Germany), with specific primers 5′-GGAATTCAAGTGTTCCCAAAAAACCTTAATTGG-3′ (EcoRI site is underlined) and 5′-GCTCTAGATTACAAAACACACTTAGGAAGTGG-3′ (XbaI site is underlined, and stop codon is in boldface), and cloned into the yeast expression vector pPICZα at EcoRI and XbaI sites. After the authenticity of the clone was confirmed by sequencing the DNA, it was integrated into the Pichia genome according to the manufacturer’s instructions (Pichia expression kit, version F; Invitrogen, Carlsbad, Calif.). The K79E and K79D mutations almost completely abolished the interaction with the HHV-6B gH/gL/gQ1/gQ2 complex (). Louis, Mo.) in 10 mM sodium phosphate (pH 7.4), containing 250 mM NaCl, followed by a heparin-agarose column (Sigma) in 10 mM sodium phosphate (pH 7.4) and a Mono S column (Pharmacia, Uppsala, Sweden) in 5 mM sodium acetate (pH 4.0). Elution of the expressed protein from these columns was achieved with a linear salt gradient of 0 to 1 M. Our purification data clearly indicated that, like the vaccinia virus CCP (VCP) (21), the ORF 4 protein, with its five putative heparin-binding sites, also bound to heparin (data not shown).

Among the human complement regulators, factor H and C4bp bind to heparin (18), and interaction of factor H with heparin is an important step in the regulation of activation of the alternative pathway (12). Whether the interaction of the ORF 4 protein with heparin is fortuitous or has any physiological relevance requires further study. The purified ORF 4 protein migrated as a single band of 56,000 Da (Fig. 1). To confirm the identity of this protein, it was subjected to automated Edman degradation (Biomolecular Research Facility, University of Virginia, Charlottesville). The predicted N-terminal sequence of this protein is E-A-E-A-E-F-K-C-S-Q-K-T-L, where the first six residues, EAEAEF, are the result of cloning the ORF 4 protein into the Pichia vector. The amino acid sequence of the expressed protein corresponded to the predicted sequence, thus confirming its identity and purity and indicating that the signal peptide was cleaved in the mature protein.

American Society for MicrobiologyJournal of Virology
The calculated mass of the expressed protein was 27,838 Da, but it migrated as a band of 56,000 Da. This apparent higher molecular mass could reflect glycosylation of the protein, since the primary sequence contains three potential N-linked and several potential O-linked carbohydrate sites. To assign a function to the ORF 4 protein, we studied the ability of the expressed protein to inhibit the complement-mediated lysis of erythrocytes (19), comparing its activity to that of VCP, which was expressed and purified as previously described (15). We chose hemolytic assays because these assays have been used in the past to quantitate the effect of CCPs and inhibitors (6, 15); thus, 50% inhibitory concentrations would be useful for comparison purposes. The amino acid sequence for the antigenic peptide is indicated. 2). Thus, our data clearly demonstrate that the ORF 4 encodes a functional RCA that is capable of inhibiting both the classical and alternative pathways of complement activation.

Remarkably, UL141 displays no structural homology to TNF superfamily ligands, and instead utilizes its Ig-domain to bind with high affinity to the TRAIL death receptor. The newly formed C3b attaches covalently to the activating surface, which then furthers the activation process by initiating the formation of the membrane attack complex (8). The RCA proteins are known to act at the level of the C3 convertase, and previous studies have shown that viral homologs of CCP also regulate C3 convertase formation (3, 5, 10, 13, 15). In some experiments, samples were additionally stained en bloc with 0.1% tannic acid in Veronal acetate buffer, pH 7.4, for 30 min at 25°C. 3 indicate that the ORF 4 protein inhibits the deposition of C3b on the activating surface. This effect of the ORF 4 protein is specific, as bovine serum albumin (a nonspecific control) had no effect on the C3b deposition. Thus, like other viral homologs, the ORF 4 protein apparently acts at the level of C3 convertase formation.

Antibodies and reagents.Apoptosis analysis by Western blotting (WB) was performed using the following antibodies: rabbit polyclonal IgG anti-poly(ADP-ribose) polymerase (PARP) (Cell Signaling Technology, Beverly MA), rabbit polyclonal IgG anti-caspase 3 active form (Abcam, Cambridge, United Kingdom), rabbit polyclonal IgG1 anti-caspase 8 (Cell Signaling Technology), and mouse monoclonal IgG2a anti-phosphor-IκBα (Santa Cruz Biotechnology, CA). Dissociation of C3 convertase limits complement activation; however, the dissociated subunits of C3 convertases (C3b and C4b) are capable of forming new C3 convertases. Monoclonal antibodies (MAbs) to CD134 were produced as described previously (20). In order to further define the mechanism of C3 convertase regulation by the ORF 4 protein, we asked whether it is capable of serving as a cofactor for factor I-mediated cleavage of C3b and C4b. The data provided in Fig. 4 show that incubation of C3b or C4b with the ORF 4 protein and factor I results in cleavage of C3b and C4b; incubation of C3b or C4b with factor I alone did not result in C3b or C4b cleavage (data not shown). Thus, our data indicate that the ORF 4 protein supports the factor I-mediated cleavage of both C3b and C4b.

Synthetic peptides mimicking the R and M cleavage sites were examined for their susceptibility to hydrolysis by recombinant, mature HHV-6 proteinase, purified to homogeneity as described previously (7). HHV-6 GS strain was propagated and concentrated as described previously (32). The boxes below the kilobase marker indicate DNA probes (1 to 42) that were used … Consistent with this prediction is the finding that expression of MCP in the absence of other viral proteins results in cytoplasmic localization (Beaudet-Miller et al., 1996; Lai and Britt, W. Region II is characterized by variability within the 5′ noncoding region of the thymidylate synthetase (TS) gene, which has been tentatively mapped as the origin of lytic replication in SaHV-2 (55), and by the presence of an additional 168-bp repeat sequence, composed of 15.3 copies of an 11-bp unit, downstream of ORF71. In-drop cleavage of ΔC-L-terminase resulted in formation of a stable nuclease core (ΔC-nuclease), which gave microcrystals of ∼30 × 30 × 20 μm3 within 1–2 months, in the presence of 0.2 m magnesium sulfate and 20% w/v PEG 3,350, at pH 6.0. To identify which domain(s) in CD134 is required for HHV-6B glycoprotein complex binding, we constructed several CD134 deletion mutants and transfected 293T cells with plasmids expressing these mutants together with the gH, gL, gQ1, and gQ2 subunits of HHV-6B.

The inner layer (green in ) forms a network of density enclosing the capsid, and interacts directly with the capsid through linker densities. Lane 1, molecular weight (MW) markers (numbers in kilodaltons); lane 2, culture supernatant; lane 3, purified kaposica. Inhibition of alternative and classical pathway-mediated lysis of erythrocytes by kaposica and VCP. The relative effects of kaposica and VCP on the alternative pathway (AP)-mediated lysis of rabbit erythrocytes and the classical pathway (CP)-mediated lysis of antibody-coated sheep erythrocytes were examined as previously described (19). Bovine serum albumin (BSA) was included as a nonspecific control. The C-terminal half of α4 and the N-terminal half of α10 are surrounded by five α helices (α5, α6, α7, α8, and α9) and form a compact fold of SD3. Inhibition of C3b deposition on erythrocytes during complement activation by kaposica and VCP.

Classical pathway-mediated C3b deposition on erythrocytes was measured by incubating 5 μl of antibody-coated sheep erythrocytes (109/ml in GVB++: 5 mM barbital, 145 mM NaCl, 0.5 mM MgCl2, 0.15 mM CaCl2, and 0.1% gelatin, pH 7.4) with 1 μl of C8-deficient human serum (Calbiochem, San Diego, Calif.) and 44 μl of GVB++ or GVB++ containing 2 μM kaposica or VCP at 37°C for 30 min. Deposition of C3b was detected by fluorescence-activated cell sorting with fluorescein isothiocyanate-conjugated F(ab′)2 anti-C3 goat immunoglobulin G (Cappel Laboratories, Warrington, Pa.). Control samples contained either 10 mM EDTA or 2 μM bovine serum albumin (BSA). Analysis of factor I cofactor activity of kaposica and VCP for complement proteins C3b (upper panel) and C4b (lower panel). Cofactor activity was observed by incubating C3b or C4b (4 μg) with kaposica (2 μg) or VCP (2 μg) and factor I (100 ng) in 15 μl of 10 mM sodium phosphate, pH 7.4, containing 145 mM NaCl at 37°C for the indicated time period. Cleavage products were visualized by running the samples on sodium dodecyl sulfate-8 and 9% polyacrylamide gels for C3b and C4b, respectively, and staining them with Coomassie blue. During C3b cleavage, the α′ chain is cleaved into N-terminal 68-kDa and C-terminal 43-kDa fragments; the appearance of these fragments indicates the generation of iC3b (inactive C3b).

In the case of C4b cleavage, the α′ chain is cleaved into N-terminal 25-kDa, C-terminal 16-kDa, and central C4d fragments; these cleavages result in inactivation of C4b and generation of C4c and C4d. We thank Jens-Christian Albrecht and Frank Neipel (Institut für Klinische und Molekulare Virologie, Erlangen, Germany) for providing the HHV-8 CCPH clone, Maria Rosa Sarrias (Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia) for expanding the HHV-8 CCPH clone, and Michael Pangburn (Department of Biochemistry, University of Texas Health Science Center, Tyler) for the generous gift of complement proteins C3 and factor I. We also express appreciation to Yogesh Panse and Sharanabasava for excellent technical assistance and Ashwini Atre for fluorescence-activated cell sorting analysis. This work was supported by the Wellcome Trust Overseas Senior Research Fellowship in Biomedical Science in India to A.S. and National Institutes of Health grants AI30040 and AI048487 to J.D.L. We also acknowledge financial assistance to A.K.S. by the Council of Scientific and Industrial Research, India.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

The commitment at the National Zoo to save Asian elephants from extinction and ensure a future for this endangered species spans more than 50 years. Here are a few news stories we wanted to make sure you didn’t miss. Fast results. Elephant endotheliotropic herpesviruses (EEHV) or Elephantid herpesvirus 1′ is a type of herpesvirus, which can cause a highly fatal hemorrhagic disease when transmitted to young Asian elephants. The 200-acre Ringling Center for Elephant Conservation already housed 29 Ringling elephants who had either been retired from performing or had never been used to perform. With an annual attendance of around 1.8 million, this zoo caters to a diverse group of visitors, from all age and socio-economic groups. The event will showcase the many ways museums support learning experiences, serve as community anchors, and are stewards of cultural and scientific heritage through the preservation of their collections.

American Society for MicrobiologyJournal of Virology
Welcome back! Stress, resulting from recent transport, and antimicrobial therapy may have contributed to the death of this animal. The genomes of the first three types of EEHVs (or probosciviruses) identified have been partially characterized in the preceding accompanying paper (L. The Houston Zoo currently has seven elephants on site, but Howard says that they have shed EEHV from their trunks and have had a low level of EEHV-1 detected in their blood. The official site changed from .com to .org with this transfer of duties. A laboratory for collecting and diagnostic testing of suspected samples has been set up by the Kerala Wildlife Service in association with National Elephant Herpesvirus Laboratory in Washington DC, and the Johns Hopkins University Herpesvirus research group. In total, approximately 5,000 individual cases will be handled by the clinical pathology lab this year.

Backues,K.A., Aguilar,R.A., Hill,M., and Palemberg,A.C. Lock, R. Founded in 1922, the Houston Zoo is an exciting live animal adventure that provides a unique educational and conservation resource serving more than 1.9 million guests annually. Read more… Y. Otherwise, you will have to find parking outside the zoo area. Because of her veterinary degree, she was eligible to apply for a National Institutes of Health K08 grant, which supports research training for people with clinical degrees.

Hayward, J. Monitoring and Outreach for Desert Elephants of the Southern Kunene, Namibia This project implements population census and distribution surveys of the southern Kunene desert elephants. Pathological samples, including both peripheral whole blood and all necropsy tissues tested by PCR carry high levels of EEHV DNA (4, 10, 13, 14). and Barnum & Bailey Center for Elephant Conservation. Monitoring and Outreach for the Desert Elephants of the Southern Kunene, Namibia This project implements population census and distribution surveys of the southern Kunene desert elephants, integrates this information in the Kunene Regional Ecological Assessment — an ongoing multi-stakeholder project to develop synchronized, incentive-driven, community and science-based land management plans, and fosters sustainability by ensuring all activities are cost-effective and fully supported by the stakeholders.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Herpes simplex virus type 1 packages its DNA genome into a precursor capsid, referred to as the procapsid. During this time, the viral core, which houses the genome, undergoes a poorly understood process of disassembly, known as uncoating. Here, we show that localization of the VP1/2 capsid-binding domain (VP1/2cbd) into assemblons is conserved in herpes simplex virus type 1 (HSV-1) and that this recruitment is specifically on capsids. However from 3 h to 6 h postinfection (the late phase of the replication cycle), the association decreases. Note the presence of electron-dense structures connecting capsid corners with the centers of nuclear pores (arrowheads in panels D and H). Although early work suggested that uncoating occurs immediately following viral entry in the cell, thus attributing a trivial role for the capsid in infected cells, recent data suggest that uncoating occurs several hours later and that capsid has an all-important role in the cell that it infects: for transport towards the nucleus, reverse transcription and nuclear import. Overexpression of pUL25, GFPUL25, or UL25GFP prior to infection reduced gene expression of HSV-1.

Confocal microscopy confirmed that all mutants retained the ability to support formation of ICP8-positive nuclear replication foci, to which AAV Rep78 colocalized in a manner strictly dependent on the presence of AAV single-stranded DNA (ssDNA). R. C. Most likely, capsids lose their envelope before moving to the neuronal cell bodies located in cranial ganglia (3–5). In this report, we demonstrate that the disulfide bond profiles of the viral proteins UL6, UL25, and VP19C and the viral protease, VP24, are altered in cells infected with a newly isolated UL32-null mutant virus, suggesting that UL32 acts as a chaperone capable of modulating disulfide bond formation. 31:299-314, 1979), and thus this gene appears to be a late function. This layer is lost when the enveloped particle fuses with the outer nuclear membrane and the capsid is released into the cytoplasm, where it gains the tegument and subsequently an outer envelope (49; reviewed in references 33 and 52).
American Society for MicrobiologyJournal of Virology

Late mRNAs are made after DNA replication (a lot of newly made viral DNA is now available as template). The capsomeres are hexamers (hexons) and pentamers (pentons) of the major capsid protein VP5 that form a shell with a triangulation number of T = 16. Finally, the outermost layer consists of a lipid membrane embedded with the viral glycoproteins. Capsid assembly and genome encapsidation in the herpesviruses are reminiscent of processes found in the double-strand DNA bacteriophages, such as T4, T7, P22, HK97, and λ, which have provided excellent model systems for HSV and the other herpesviruses (13, 76). Stow, J. These data suggest that in the absence of UL37, the exit of capsids from the nucleus is slowed. These complementing cells were then transfected with UL93st-TB40/E-BAC to grow this virus.

In particular, FV PRs are enzymatically active as high-molecular-mass Pro-Pol proteins (11), and their catalytic center consists of D-S/T-Q instead of D-S/T-G for other retroviral PRs. PrV UL25 was found to be essential for viral replication, as a mutant virus lacking the UL25 protein required UL25-expressing cells for productive propagation. In the absence of the UL25 protein, newly replicated PrV DNA was cleaved and DNA-containing C-type capsids were detected in infected cell nuclei. However, although capsids were frequently found in close association with the inner nuclear membrane, nuclear egress was not observed. With sound architectural details established to better than 1 nm resolution for the four major capsid proteins, structural data for these essential minor components are necessary for understanding their function in the DNA packaging reaction, and for developing new targets for anti-viral therapeutics. In contrast, the formation of capsidless enveloped tegument structures (L particles) in the cytoplasm was readily observed. For such retroviruses, evidence suggests that the viral capsid accompanies the viral genome into the nuclear compartment and participates in interaction with the chromatin [19] indicating that uncoating is not required prior to nuclear import.

In this review, we describe the different mechanisms of nuclear transport for adenovirus, herpesvirus, picornavirus, orthomyxovirus, rhabdovirus, retrovirus and hepadnavirus and discuss the host cell factors subverted by these viruses during import and export events (Table 1). A B Figure 8 Models of the adenovirus virion. (A) Top view of a pentonless B capsid with arrows pointing to 3 holes at the position of the missing pentons.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

[embedded content] HSV was isolated from the genital mucosa 38 of the 53 HSV-2 seropositive subjects who reported no history of genital herpes, and HSV DNA was detected by the polymerase-chain-reaction assay cultures prepared from genital mucosal swabs 6 additional subjects. They gave him tons of ice baths. When your brain becomes inflamed or infected, the problem is called encephalitis. The song ”big bottom” that appeared in the movie ”This is spinal tap” is taken from Ian GIllan’s song ”Puget sound” of the album ”Ms Universe” realesed in 1979!! Normally it lasts two to twelve days. The virus may spread from these areas into the spinal fluid that cushions the brain and spinal cord. This disease is often fatal when it is not treated.

The Folksmen have opened for Tap in the past, but their sets were always mysteriously cut short. Any information I can get will be much appreciated. A. ICP47 binds to human transporter associated with antigen-processing proteins (TAP), thereby inhibiting peptide loading on MHC class I and recognition by HSV-specific, MHC class I-restricted, CD8+ T cells (1,14, 42, 43). This effect is greatest in nonhematopoietic cells in which the abundance of MHC class I and TAP are lower than in antigen-presenting cells (41). Thus, immune evasion is probably important to reduce the effects of antiviral immunity until progeny can be produced. At first the infection may cause flulike symptoms, including fever and muscle aches, especially headache.

PMC 452208. It’s all about the timing folks…timing of the tests being done not only when it comes to blood work but even with swabbing the actual sores/blisters during an OB. In patients with AIDS, a lower frequency in the blood of HSV antigen-specific CD8+ CTL precursors is associated with more frequent and severe recurrences of genital disease (32). These correlative data suggest that CD8+ T cells may play an important role in the clearance of HSV in humans, at least from mucocutaneous lesions. These include the method each lab uses to do the test. any history of herpes infections when and how long you have had symptoms other health problems you have that might make it harder for the body to fight infection, such as cancer, diabetes, or autoimmune diseases. These findings are consistent with data suggesting that CD8+ T cells limit persistence of HSV in the spinal ganglia and decrease spread to the central nervous system (35, 36).

However, other studies have concluded that CD4+ T cells but not CD8+ T cells play the critical role in viral clearance and protection from lethal primary infection with wild-type HSV (20, 23, 24) or that either CD4+ or CD8+ T cells are sufficient for protection (26, 37). Since the effects of ICP47 are likely to be greater in humans than in mice, if MHC class I-restricted CD8+ T cells do not play an important role in protection of mice from lethal, neuroinvasive infection due to wild-type HSV, an important role in humans would be unlikely. However, with some strains of HSV-1, latency is incomplete, and the virus can spread from ganglia to the central nervous system and cause encephalitis. Studies by Simmons and colleagues suggested that CD8+ T cells may lyse infected Schwann cells or satellite cells but that they probably do not lyse infected neurons (31, 32). They and others have proposed that CD8+ T cells protect neurons through the production of cytokines, in particular IFN-γ (35, 36). IFN-γ contributes to the clearance of HSV from mucocutaneous sites (4,24, 25, 37, 44). However, the role of IFN-γ in protection from lethal, neuroinvasive infection is uncertain and may vary with the strain of mice, method used to inhibit IFN-γ function, and route of inoculation (4, 5, 24, 37, 44).

Avoid kissing people with cold sore blisters. Christopher Guest enjoyed the mockumentary concept so much that he continued to use it in his own movies, directing such comic gems as “Waiting for Guffman,” “Best in Show,” and “A Mighty Wind.” Shearer, McKean, and Begley are among Guest’s talented group of improvisational actors who have appeared in these movies. Thus, it is possible that the disparity in results regarding the relative importance of CD4+ and CD8+ T cells in protection from lethal, neuroinvasive HSV infection reflects their redundant roles in production of this cytokine or that IFN-γ and CD8+ T cells contribute independently to control of infection in the nervous system. Because the brain controls thinking and moving, there may be temporary or permanent loss of these abilities. With treatment, most people with this disease start to improve within a day or two and tend to recover fully within about a month. These findings indicate that MHC class I-restricted T cells play an important role in protection against neuroinvasive HSV infection in mice and that they do so largely by mechanisms other than the production of IFN-γ. Though MHC class I expression is more severely impaired in β2KO mice than in human cells infected with wild-type HSV, these findings support the notion that inhibition of MHC class I expression is an important factor in the virulence of this virus.

When these genes are inactivated in combination with deletion of ICP4, toxicity is eliminated (52). B6 congenic β2KO mice (17, 33) were obtained from Jackson Laboratories; wild-type B6 mice were used as controls. IFN-γKO mice on a mixed B6 × 129 background were obtained from Tim Stewart (Genentech, South San Francisco, Calif.). The wild-type HSV-1 strain F was obtained from Dr. Tell your provider if you are having new symptoms or you feel your treatment is not helping. “The potential for efficacy of the modified (ICP 34.5−) herpes simplex virus HSV1716 following intratumoural injection into human malignant glioma: A proof of principle study”. Animals were housed under specific pathogen-free conditions and were used at 8 to 18 weeks of age.

Virus.The wild-type KOS strain of HSV-1 was a gift of Edward Wagner (University of California, Irvine). Virus stocks were produced and titrated in mycoplasma-free Vero cells. A lysate of uninfected (mock) Vero cells was prepared in parallel. When you have blisters: Avoid touching the blisters. Analysis of the course of HSV infection.The footpad model of infection was used (3, 6, 7). Mice were anesthetized with ketamine-xylazine, and the hind footpads were injected intradermally with 100 μl of pyrogen-free 9% NaCl solution. Two to three hours later, both footpads were gently abraded and then inoculated topically with 10 μl of virus diluted to yield the desired inoculum.

To rule out the possibility of additional mutations in F-ICP47Δ, a rescued virus, able to express ICP47, was derived from F-ICP47Δ. In preliminary experiments, it was found that >80% of mice which developed bilateral hind limb paralysis or gross motor ataxia died within 24 to 36 h. Thus, in subsequent experiments, mice which developed paralysis or ataxia were immediately euthanized. One outcome variable analyzed was the number of days mice survived without developing paralysis or gross ataxia. The other outcome variable analyzed was clearance of virus from the feet and nervous system. For determination of viral concentrations, both hind feet and the lumbosacral dorsal root ganglia and associated spinal cord were snap frozen and stored at −80°C. Tissues were subsequently homogenized in phosphate-buffered saline (PBS), diluted serially, and titrated by plaque assay on Vero cells.

The viral density was corrected for the weight of the tissues and expressed as log10 PFU per gram of tissue. Last modified: 2011-01-05 Last reviewed: 2011-01-03 This content is reviewed periodically and is subject to change as new health information becomes available. Lymph nodes from mice of the same genotype were pooled for analysis. Single-cell suspensions were obtained by pressing tissue through fine mesh sieves, and then cells were washed once and resuspended in HL-1 medium (Biowhittaker, Walkersville, Md.) at a concentration of 2.5 × 106 cells/ml. Cells were added to wells of microtiter trays to which medium alone (unstimulated), anti-CD3 monoclonal antibody (1452C11) at an optimal concentration (positive control), HSV antigen (UV-inactivated viral stock) in a concentration ranging from 1:2,500 to 1:10,000, or mock antigen (UV-inactivated, sham-infected Vero cells) was added. Extended expression of a transgene in the CNS, other than in a very few cells (6, 27, 37), has not previously been reported with HSV vectors. Supernatants harvested after 72 h from additional microtiter wells were assayed for IFN-γ, interleukin 10 (IL-10), or IL-4 by enzyme-linked immunosorbent assay as described previously (15) with antibody pairs and recombinant standards obtained from Genzyme (Cambridge, Mass.).

American Society for MicrobiologyJournal of Virology
Assessment of anti-HSV antibody production.Preinfection sera and sera obtained at the time of sacrifice were collected and stored at −80°C. HSV-1 replication in corneal epithelial cells results in pathognomonic dendritic-shaped lesions that stain with fluorescene. Plates were coated overnight with 1 μg of recombinant glycoprotein B (a gift from Chiron Corp, Emeryville, Calif.) per ml in carbonate buffer (pH 9.6), blocked with PBS containing 3% bovine serum albumin and 0.05% Tween 20, washed, and incubated with serum samples that were diluted serially in 10% PBS, 0.3% Tween 20, and 0.01 M EDTA. doi:10.1038/sj.gt.3301205. Statistics.The significance of differences in levels of paralysis-free survival was determined by life-table analysis and log rank test, and differences in viral concentrations in tissues were determined by Student’s two-tailed t test on log-transformed viral titers with Statview software (Abacus Concepts, Berkeley, Calif.). MHC class I-restricted T cells play a critical role in defense against HSV after footpad inoculation.To explore the role of MHC class I-restricted T cells in resistance to primary infection with HSV, β2KO mice and heterozygous littermate controls were challenged by bilateral footpad inoculation. In this and similar models, virus is cleared from the skin and spinal ganglia between days 5 and 10 in a T-cell-dependent manner (3, 6, 7, 26, 35, 36).

As previously reported for mice of the B6 background, controls were relatively resistant to HSV: in three independent experiments, 60 to 86% of wild-type B6 mice survived without neurological signs after bilateral footpad inoculation with 7.5 × 106 PFU, the highest inoculum tested. In contrast, β2KO mice were markedly compromised: more than 50% died or developed hind limb paralysis and/or marked ataxia after infection with doses as low as 7.5 × 104PFU (Fig. 1). In the experiments whose results are shown, paralysis or death occurred by 13 days, but in other experiments occasional deaths occurred in β2KO mice (but not wild-type B6 or heterozygous littermate control mice) as late as the 19th day. Outcome of HSV infection in β2KO (▵) and control (●) mice. The mAb treatments were given 1 day before infection, and 2, 6, and 12 d after infection. The numbers of mice per group and P values by log rank test were 7 β2KO mice, 6 controls, and P of 0.004 for the group inoculated with 106PFU; 20 β2KO mice, 16 controls, and a P of 0.002 for the group inoculated with 5 × 105 PFU; and 6 β2KO mice, 6 controls, and a P of 0.14 for the group inoculated with 7.5 × 104 PFU.

The role of IFN-γ compared to that of MHC class I-restricted T cells in resistance to acute HSV infection.The mechanisms by which MHC class I-restricted T cells protect against HSV is not certain. In addition to cytolytic function, these cells are potent producers of IFN-γ and tumor necrosis factor (TNF), production of which has been proposed as a mechanism by which HSV may be cleared from neurons without their destruction (5, 12, 29, 35, 36). If production of IFN-γ is an important mechanism by which MHC class I-restricted T cells control HSV infection and these cells are an important source of IFN-γ, then (i) IFN-γKO mice should be more susceptible to HSV and (ii) the contribution of IFN-γ should be less evident in β2KO mice. Following inoculation with 7.5 × 106 PFU, the survival of IFN-γKO mice (56%) did not differ from that of wild-type B6 mice (71%, n = 16, P = 0.23). Also, following inoculation with 5 × 105 to 5 × 106PFU, the survival of IFN-γKO mice (13 of 17, 76%) was similar to that of heterozygous littermate controls (14 of 17, 82%). When β2KO mice were crossed with IFN-γKO mice and littermates of the four resultant genotypes were infected with >106 PFU, there was no difference in outcome between IFN-γ heterozygous/β2KO and IFN-γKO/β2KO mice: ≥80% died or developed hind limb paralysis between days 6 and 12, whereas >50% of IFN-γKO/β2 heterozygous and IFN-γ heterozygous/β2 heterozygous mice survived without neurological signs for up to 21 days (data not shown). However, when these groups of mice were infected with smaller amounts of virus, there appeared to be a modest contribution by IFN-γ to protection.

In these experiments, one cohort of mice of each of the four genotypes was monitored to determine the fraction that developed paralysis or died by day 10, when the survivors were sacrificed and viral concentrations in the feet and lumbosacral ganglia and spinal cord were determined; viral concentrations in another cohort infected in parallel and sacrificed on day 7 or 8 were also evaluated. Following inoculation with 5 × 105 PFU, survival was lowest in the IFN-γKO/β2KO mice, greater in IFN-γ heterozygous/β2KO mice, even greater in the IFN-γKO/β2 heterozygous mice, and greatest in IFN-γ heterozygous/β2 heterozygous mice (Fig.2). These results provided further evidence that MHC class I played a critical role in protection from lethal HSV infection and suggested an incremental, and partially independent, contribution of IFN-γ to protection. Viruses.The shuttle plasmids described above were recombined into either virus strain 17+ 27− (26) or virus strain 1764 27− (12) by standard calcium phosphate techniques (60). The results show the fraction of mice surviving to day 10 (at which time surviving mice were sacrificed) without neurological impairment (paralysis or gross motor ataxia) over time in days after bilateral footpad inoculation with 5 × 105 PFU/footpad. The concentrations of virus in the footpads and spinal ganglia of the sacrificed mice are shown in Table 1, experiment 1. At the higher doses of virus, corneal stromal inflammation and periocular skin disease were difficult to compare because most mice infected with F-ICP47ΔR or wild-type HSV-1 died of encephalitis.

The overall levels of survival survival were different by log rank test (P = 0.005). Human Gene Therapy 23 (1): 91–7. Consistent with this notion, by day 10 the amounts of virus present in the spinal ganglia and feet of IFN-γKO/β2KO mice were consistently greater than in the other three groups, even in the few mice of this genotype that survived to day 10 (Table1, experiment 1). The amounts of virus were also increased in the IFN-γKO/β2 heterozygous and IFN-γ heterozygous/β2KO mice compared to amounts in control mice heterozygous for both genes. The difference between the groups became evident only during the period (5 to 10 days after inoculation) when viral clearance is mediated by T cells (3, 7, 26, 34-36). There was no difference among the four groups in the amounts of virus in the feet and spinal ganglia 3 days after inoculation (not shown). Differences were first evident at days 7 and 8, and differences were greatest at day 10 (Table 1).

Since mice that died were shown in other experiments to have high concentrations of virus in the feet and spinal ganglia (not shown), the results shown in Table 1 may underestimate the magnitude of the differences in viral burdens between the IFN-γKO/β2KO and IFN-γ heterozygous/β2KO mice and the other two groups. A similar trend of greater virus concentrations was seen in mice inoculated with 106 PFU (Table 1, experiment 2) and when IFN-γ wild-type β2KO mice were compared to IFN-γ wild-type β2 heterozygous mice (not shown). Lymphocyte proliferation, cytokine production, and antibody production are not impaired in β2KO mice.As expected, the numbers of CD8+ T cells were profoundly reduced in the draining lymph nodes of β2KO mice. A rescued derivative of F-ICP47Δ, denoted F-ICP47ΔR, was produced by cotransfecting cells with F-ICP47Δ DNA and a plasmid containing the wild-type US12 gene. NK1.1+ T cells were rare even in the nodes of control mice. Proliferation and cytokine production in response to HSV antigen by cells from the draining lymph nodes were detected 8 and 10 (but not 3) days after infection (Table2). Results with cells from the four groups were similar, with the exception that IFN-γ was not detected in culture supernatants from IFN-γKO mice.

Lymphocyte proliferation responses in the β2KO groups at day 10 were greater in the experiment whose results are shown, but this was not observed in a second experiment and was not observed in either experiment at days 7 to 8 (Table 2 and data not shown). The high [3H]thymidine uptake in unstimulated cultures at day 8 likely reflects the presence of cells proliferating in situ prior to isolation and may have masked, at least in part, HSV antigen-specific proliferation as assessed in vitro. IL-10 production by cells from IFN-γKO mice was not increased (Table 2), and IL-4 was not detected in culture supernatants from any of the groups (data not shown). Thus, the inability to produce IFN-γ did not cause a shift in the response towards the production of Th-2 cytokines. Production of antibody to HSV glycoprotein B antigen was also similar, with the exception that the ratio of immunoglobulin G1 (IgG1) to IgG2a antibody was reduced in the IFN-γKO and IFN-γKO/β2KO mice compared to those of the other groups (Table3), as reported previously for IFN-γKO mice (27, 44). These results suggest that the functions of CD4+ T cells and B cells in β2KO mice were intact. These results indicate that MHC class I-restricted T cells play an important role and that IFN-γ plays at most a limited role in protection of B6 mice from lethal neuroinvasive HSV infection.

B6 mice, like immunocompetent humans, are relatively resistant to lethal primary HSV infection (7, 20, 35, 37). Virus strain 1764 27− 4− does not express significant amounts of any of the IE genes. Although β2KO mice have reduced NK cell function in the absence of infection and reduced numbers of NK1.1+(natural) T cells (2), it is unlikely that these differences accounted for their poor outcome. β2KO mice have a normal NK response to infection with murine cytomegalovirus (40), and the differences in disease and virus concentrations in tissues in this study first became evident by days 7 to 8, during the period when antigen-specific mechanisms act to clear the infection (3, 7, 26,34-36). To determine whether CD4+ T cells contribute to the reduced neurovirulence, we initially attempted similar in vivo depletion experiments involving an anti-CD4 mAb, but these studies were inconclusive because depletion of CD4+ T cells caused significant reductions in CD8+ T cell infiltration into ganglia (data not shown). These results extend those of Goldsmith and colleagues (12) by demonstrating an important role for CD8+ T cells in the control of infection with wild-type HSV and not just with HSV mutants lacking ICP47. The current results differ somewhat from those of Manickan and Rouse (20), who concluded that β2KO mice on a B6 background were as resistant as controls to lethal HSV infection following flank inoculation, whereas mice lacking CD4+ T cells were highly susceptible.

In their studies, mice were challenged either with a very high dose (108) of HSV, which was lethal for 100% of wild-type mice, or a very low dose (104), which was lethal only for the CD4+ T-cell-deficient mice. In the present study, in which intermediate doses of virus were inoculated into the footpads, the 50% lethal dose for β2KO mice was at least 2 log10 lower than that for controls. The varying conclusions reached in other studies regarding an independent role for MHC class I-restricted T cells in protection against wild-type HSV in the mouse may be related to differences in the methods of infection, methods by which the contributions of different T-cell subsets were assessed, and strains of mice (12, 23, 24, 26, 34, 35, 37). Nonetheless, more profound defects in the control of primary HSV have been observed in CD4+ KO mice than in β2KO mice (20) and in mice depleted of CD4+ T cells than in mice depleted of CD8+ T cells by treatment with monoclonal antibodies (23, 24). This may reflect a role for CD4+ T cells in multiple aspects of antiviral defense, including a requirement for these cells in the generation and survival of effector CD8+ CTL and in the upregulation MHC class I expression on infected cells in the tissues (21, 24, 37,38). The mechanisms by which CD4+ or CD8+ T cells limit viral replication in the tissues and peripheral nervous system and spread to the central nervous system are not fully defined and are likely to be multiple (12, 20, 36). IFN-γ appears to contribute to the clearance of HSV outside of the nervous system in mice (4, 24, 37, 44).

However, conclusions regarding the role of IFN-γ in protection from lethal nervous system infection with HSV have been highly varied (4, 5, 24, 37, 44). 3). These results are similar to those of Cantin et al. (5), who found a small but reproducible difference in levels of viral clearance and survival in mice in which the action of IFN-γ was blocked. The contribution of IFN-γ appeared to be at least partially independent of the contribution of MHC class I, suggesting that MHC class I-restricted T cells are not the major source of IFN-γ in this infection and that IFN-γ is not the major mechanism by which these cells contribute to protection. These conclusions also suggest that the role of IFN-γ in HSV infection is not limited to upregulation of MHC class I but that it may include induction of MHC class II, protection of neurons from apoptosis, and inhibition of HSV replication (5, 9, 10, 13,18). Though TNF may contribute to noncytolytic inhibition of HSV replication and upregulation of MHC class I expression in the nervous system (9, 11), the outcome of HSV infection in type I TNF receptor KO mice on a B6 background (30) was similar to that in controls in preliminary experiments (unpublished observations).

TNF and IFN-γ may play partially redundant roles in the control of HSV, but the greater severity of HSV disease in β2KO mice than in IFN-γKO or type I TNF receptor KO mice suggests that T-cell-mediated protection from HSV is not mediated solely by these cytokines. The present results do not exclude a role for these cytokines in CD8+ T-cell-mediated control of HSV infection but suggest that other mechanisms are more important. There is considerable evidence that other cells, including γδ T cells, NK cells, CD4+ T cells, and neurons themselves may produce IFN-γ and TNF in response to HSV in the nervous system, so this function of CD8+ T cells is likely to be redundant. In summary, this study indicates that MHC class I-restricted T cells play an important role and that IFN-γ plays a limited role in protection of mice from lethal nervous system infection due to wild-type HSV. The importance of MHC class I expression is consistent with the presence of two viral genes that inhibit MHC class I-mediated antigen presentation and with the reduced neurovirulence of strains lacking ICP47 (12) and vhs (39), though in the latter case it is not certain that the lower neurovirulence results from evasion of host defenses. IFN-γ can override the effects of ICP47 on MHC class I expression (22, 41), suggesting that IFN-γ may play a more critical role in the control of HSV in humans than in mice. In Fig.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Lawrence R. METHODS: A longitudinal study was conducted among 411 women aged 18 – 35 years at high risk of HIV acquisition (defined as having had two or more sexual partners in the month prior to study enrolment). For statistical analysis a control who remained seronegative during the same interval was selected at random for each HIV-1 seroconverter. Shepherd 1 2 Jonathan M. Population attributable fractions of incident HIV infection due to HSV2 were estimated as 74% in men and 22% in women. Compared to those detected after seroconversion, these responses were of lower magnitude and half of them targeted different regions of the viral proteome. The HSV 1 and HSV 2 seroprevalence at entry was 59.6% and 13.5%, respectively.

Multivariate logistic regression revealed rectal gonorrhoea to be independently associated with risk of seroconversion (odds ratio = 3.18; p = 0.044), whereas urethral gonorrhoea (p = 0.479) and pharyngeal gonorrhoea (p = 0.434) were not after inclusion of rectal gonorrhoea. Among heterosexuals, excess risk was noted for men who had sex with women in risk categories defined by the Centers for Disease Control and Prevention (odds ratio = 10.0; 95% confidence interval = 1.3, 78.1). As the number of exposures of HCWs to AIDs patients increases, the risk to the workers may also increase. In a cohort of female commercial sex workers in Nairobi, Kenya, a small proportion of individuals remained seronegative for over 3 years despite the continued practice of unprotected sex (12, 28, 55, 56). At study entry, 41% of the girls reported a history of sexual activity, and by the end of the study, 73% reported a history of sexual activity. Conversely, having been forced to have sex in the last month (aOR=0.31, 95% CI: 0.15–0.66, P=0.003) was associated with reduced risk of prevalent HSV-2 infection. These data suggest little evidence for genital ulcerative infections being an important independent risk factor for HIV-1 acquisition among homosexual men in Amsterdam during the time period studied.

The human experimentation guidelines of the US Department of Health and Human Services and of participating institutions were followed in conducting this research. Zhu, T. Andrus, Y. Serum specimens were tested for HSV 1 and HSV 2 antibody, and genital specimens were tested for HSV DNA by PCR. Zhu, unpublished observations). Here, we analyze the virology, genetics, and immune responses of HIV-1 infection in one of the later seroconverting subjects, LSC63, who had developed broad CTL responses before seroconversion. The quality of the article was very good.

Detailed information about this cohort, including procedures for subject recruitment, has been published previously (1, 15, 17, 61, 66). The evaluation of these vaccines must occur in populations at high risk for acquisition of such infections. All ES enrollees completed a questionnaire concerning risk behavior and provided blood during visits scheduled monthly during the initial 3 months and every 3 to 6 months thereafter. As shown in Fig. Herpes simplex virus type 2 (HSV-2) infection is the most common cause of genital ulcer disease in both developed and developing countries [712]. The seronegative status of LSC63 upon enrollment was confirmed by HIV-1/HIV-2 enzyme-linked immunosorbent assay and Western blot assay (60), HIV-1 plasma RNA reverse transcription-PCR (Amplicor HIV-1 monitor; Roche, Branchburg, NJ), and peripheral blood mononuclear cell (PBMC) DNA PCR (52). The HIV-1/HIV-2 enzyme-linked immunosorbent assay and Western blot assay were repeated every 3 months.
American Society for MicrobiologyJournal of Virology

HIV-1 PBMC DNA PCR was performed again at 4 and 8 weeks after enrollment and then repeated yearly. LSC63 seroconverted 582 days after enrollment, after which the relationship with P63 ended. LSC63 reported engaging in unprotected anal insertive and receptive sex with four HIV-1-infected partners other than P63 and two partners with unknown HIV-1 serostatus during the period 6 to 12 months prior to seroconversion (Fig. 1A) (there is no information as to whether or not these HIV-positive partners were on antiretroviral medications). However, LSC63 engaged in sex only with P63 during the last 6 months prior to seroconversion. Reasons for nonparticipation in the study included lack of interest or time, disconnected telephone service, inability to reach both the parent (or guardian) and the adolescent, and repeated failure to attend the initial scheduled clinic visit. 1A).

Clinical, virological, and behavioral data for LSC63, P63, and PP63. The study population represents a mixture of male patients with STIs, female partners of male patients with STIs, female commercial sex workers, and women with reproductive tract infections. For the numbers of unprotected sexual contacts, the blue line shows reported sexual contacts with P63, the green line shows reported sexual contacts with other partners, and the horizontal line sections represent the total number of unprotected sexual contacts reported by LSC63 during the periods encompassed. (B) Viral loads and CD4+ T-cell counts of subjects PP63 and P63. For both panels, the areas shaded gray represent the period in which LSC63 had frequent unprotected sex with P63 and the black dashed lines indicate a viral load level of 50 copies/ml., onset of acute symptoms of viral infection; *, seroconversion;, viral sequences covering nearly the entire HIV-1 coding region were obtained; ▾, viral sequences of env C2-V5 were obtained. Before his relationship with LSC63, P63 had a sexual relationship with subject PP63 (who reported having acute symptoms of HIV-1 infection 3 months before the relationship) and subsequently developed acute symptoms. Both PP63 and P63 were enrolled in the University of Washington Primary Infection Clinic.

As shown in Fig. 1B, PP63 and P63 were found to be HIV-1 seropositive 2.8 years and 2.7 years, respectively, before the seroconversion of LSC63. Antibody to CMV was detected by use of a commercial EIA (BioWhitaker), as described elsewhere [14]. In addition, HIV-1 sequences corresponding to the env C2-V5 region were obtained from P63 on days 12, 530, 831, 1104, 1377, and 2037 after his seroconversion (−967, −449, −148, 125, 398, and 1058 days from the seroconversion of LSC63, respectively) (40). P63 received HAART from day 21 to 1052 after his seroconversion (−2.7 years to 2 months relative to the seroconversion of LSC63). Serologic testing for HIV. HIV-1 genome fragments were amplified by nested PCR using the primers listed in Table 1.

PCR conditions for env C2-V5 have been described previously (13, 36, 40). The conditions for amplification of fragments that covered nearly the entire coding region were as follows for first-round PCR: 3 min at 95°C; 30 cycles of 40 s at 95°C, 40 s at 55°C, and 2.5 min at 72°C; and 7 min at 72°C. The conditions for second-round PCR were as follows: (i) for gag, 2 min at 95°C; 35 cycles of 15 s at 95°C, 30 s at 58°C, and 2 min at 72°C; and 7 min at 72°C; (ii) for polA, vif-vpr-vpu, and gp120, 2 min at 95°C; 35 cycles of 15 s at 95°C, 30 s at 55°C, and 2 min at 72°C; and 7 min at 72°C; (iii) for polB, 2 min at 95°C; 35 cycles of 15 s at 95°C, 30 s at 61°C, and 2 min at 72°C; and 7 min at 72°C; and (iv) for gp41-nef, 2 min at 95°C; 35 cycles of 15 s at 95°C, 30 s at 60°C, and 2 min at 72°C; and 7 min at 72°C. All PCR products were gel purified and cloned using a pcR2.1 TOPO TA cloning kit (Invitrogen, Carlsbad, CA). Sequencing was performed with a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA) as previously described (13, 40). Host genetic polymorphisms associated with HIV-1 transmission.A multiplex PCR strategy was used for genotyping of CCR5-Δ32, CCR5 promoter −2459A/G, CCR2-64I, and SDF-1-3′A, and PCR-restriction fragment length polymorphism analysis was used for genotyping of the RANTES promoter, RANTES-403 and -28, DC-SIGN, and DC-SIGNR, as previously described (36, 38). A 3:1 matched ratio of control subjects to case subjects was used to evaluate HSV-2 seropositivity over time, after the evaluation of the relationship of race to HSV-2 seropositivity.

ELISPOT assays.CTL responses were measured in gamma interferon enzyme-linked immunospot (ELISPOT) assays, using cryopreserved PBMC as described previously (15, 17, 61). Fifteen-mer peptides, overlapping by 11 amino acids, were synthesized by the Biotechnology Center at Fred Hutchinson Cancer Research Center or by Synpep (Dublin, CA) or were kindly provided by the National Institutes of Health AIDS Research and Reference Reagent Program. Risk factors for prevalent HSV-2 infection were assessed using x2 and Fishers exact tests. Predefined optimal epitopes restricted by LSC63’s HLA alleles were also tested. Spot-forming cells (SFC) were counted using an automated ELISPOT reader (Immunospot; Cellular Technology, Cleveland, OH).

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

UL9 is a multifunctional protein essential for herpes simplex virus type 1 (HSV-1) replication in vivo. The minimal herpes simplex virus type 1 (HSV-1) proteins that support AAV replication in cell culture are the helicase-primase complex of UL5, UL8, and UL52, together with the UL29 gene product ICP8. In initial immunoprecipitation experiments, one of these, MAb 804, was shown to coprecipitate POL, the catalytic subunit of the HSV-1 DNA polymerase, from extracts of insect cells infected with recombinant baculoviruses expressing the POL and UL8 proteins. The Rep activities required for inhibition of HSV-1 replication precisely coincided with the activities that were responsible for induction of cellular DNA damage and apoptosis, suggesting that these three processes are closely linked. Chem. K. First, the ability of acyclovir and Foscarnet to block dNTP polymerization without impacting exonuclease activity raises the possibility that their effects on herpes replication may involve both direct inhibition of dNTP polymerization and exonuclease-mediated destruction of herpes DNA.
American Society for MicrobiologyJournal of Virology

ICP8 acts as a positive regulator by neutralizing this region. Presentation may occur at multiple stages of the viral life cycle, with cellular compartmentalization determining PAMP–PRR interactions (see Figure 1). The N-terminal two-thirds of the UL9 gene contains six sequence motifs found in all members of a superfamily of DNA and RNA helicases, suggesting that this region may be important for helicase activity of UL9. HSV-1 encodes seven proteins that are essential for DNA replication in vivo (3, 4). These findings support the model in which destabilization of the A+T-rich linker to provide a binding site for ICP8 represents the initial event in the UL9 protein-promoted unwinding of OriS. Potentiation correlates with the ability of the UL9 variants containing the G354A mutation to be processed or degraded to the 38-kDa form. Mutagenesis of any one of these conserved domains in UL5 protein obliterates viral DNA synthesis (5).

A. Our results suggest that transdominance can be mediated by overexpression, origin-binding activity, and dimerization, whereas potentiation is most likely caused by the ability of the UL9 MV mutant to influence the steady-state levels of wild-type UL9. Taken together, the results presented in this paper suggest that the regulation of steady-state levels of UL9 may play an important role in controlling viral infection.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology
UL9 is a multifunctional protein essential for herpes simplex virus type 1 (HSV-1) replication in vivo. More recently these viruses have been used as gene-transfer vectors and oncolytic agents. We examined whether adeno-associated virus (AAV) replication compartments also associate with PML NBs, and whether modification or disruption of these by HSV-1 or Ad, both of which are helper viruses for AAV, is necessary at all. ICP0-null mutant viruses are defective in PML degradation and ND10 disruption, and concomitantly they initiate productive infection very inefficiently. The results suggest that the exo activity of HSV-1 pol modulates its ability to engage in strand displacement, a function that may be important to the viability and genome stability of the virus. It is proposed to block reverse transcription of retroviral RNA into DNA by depleting cellular deoxynucleotide triphosphates (dNTPs). MSH2, on the other hand, which is generally thought to play a role in mismatch repair at a step prior to that of MLH1, is not recruited to incoming genomes and appears to act at a later step in the viral life cycle.

Interestingly, during the late phase of infection, the mutant viruses synthesized larger amounts of viral DNA than the control virus. Importantly, we found that mutations that have been shown to reduce oriS-dependent DNA replication also reduce the formation of the OBP-oriS* complex. These results demonstrate that the reduced DNA binding of UL42 is associated with significant effects on virus yields, viral DNA replication, and replication fidelity. The rolling-circle phase of HSV-1 DNA replication has been reconstituted in vitro by a complex containing several of the HSV-1 encoded DNA replication enzymes.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Herpes simplex virus type 1 (KOS)ΔgK is a mutant virus which lacks glycoprotein K (gK) and exhibits defects in virion egress (S. We applied RNAi against a herpes simplex virus type 1 (HSV-1) gene, glycoprotein E, which mediates cell-to-cell spread and immune evasion. The RF of HSV-1 ts mutants increased following 12-O-tetradecanoylphorbol-13-acetate (TPA) treatment of normal, but not BS fibroblasts, suggesting that BS fibroblasts express higher constitutive levels of genetic recombination activity. The backcrosses to BALB/c mice suggested that additional genes on this background enhanced resistance, while further backcrosses with the A/J mice indicated that other genes on the A/J background (or the lack thereof) reduced resistance. Thus, this system offers new opportunities for investigating the gene functions responsible for the virulence of HSV-1. By phylogenetic comparisons based on the sequence data, we observed two (main) genetic variants of the gG-1 gene among the clinical isolates corresponding to reactivity or nonreactivity to the anti-gG-1 MAb. The nucleotide sequences of the region encompassing reiteration VII of sixty-two isolates were compared to those of strain 17 as the standard (Table 1 ).

Analysis of the mutant n406R suggested that a truncated ICP27 polypeptide can interfere with the expression of many viral beta genes. These do not conform to any particular kinetic class. To characterize the UL17 gene product, an anti-UL17 rabbit polyclonal antiserum was produced. In contrast, phylogenetic analysis did not separate the gB sequences into main genogroups, although a relatively large sequence variability was documented. Antisera generated in rabbits against gK-specific peptides indicated that gK exists as a single 40-kDa protein species in infected cells (17). The capsid is actively transported along the host cell microtubular cytoskeleton to the nuclear pores [93], where tegument proteins facilitate the release of the virus genome into the nucleus [94] (). Initially, gK was predicted to have four transmembrane regions (7); however, experiments with in vitro-translated gK in the presence of microsomal membranes suggested that gK contained three instead of four membrane-spanning regions (27).

This topological orientation placed allsyn mutations within the proposed ectodomains of gK (10, 27). The IE genes are expressed first and are defined as capable of being transcribed in the absence of de novo viral protein synthesis (28, 29). These studies have indicated that gK is important in virion morphogenesis and egress (10, 18, 21, 22, 28). Mailing address: Department of Veterinary Microbiology and Parasitology, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803. The deletion of gE from the NS strain of HSV-1 (gEnull) produces a defect in cell-to-cell spread. Despite the established role of gK in membrane fusion, initial characterization of gK localization indicated that HSV-1 gK was retained within the endoplasmic reticulum (ER) and nuclear membranes (19). The inability of gK to be transported to the Golgi complex and, subsequently, to cell surfaces complicated the elucidation of the role gK could play in mediating cell-to-cell fusion.

Furthermore, contrary to studies with other alphaherpesviruses, including PRV and varicella-zoster virus (VZV) (22, 28), HSV-1 gK was thought not to be a structural component of virion particles (19). However, no differences in IgG reactivity were found when sera from patients harboring either of these variants were compared by gG-1 enzyme-linked immunosorbent assay (ELISA). Four kinds of multiplications were detected and named mul-1 to mul-4 (Table 3). Here we show that HSV-1 gK, like gK of other alphaherpesviruses, is a structural component of purified virions. Moreover, gK exists on purified virions and within cells as a Golgi complex-dependent glycosylated species. Previous studies have indicated that the UL16 gene encodes a virion-associated protein that is dispensable for replication in cultured cells (6, 21). To improve detection of gK, the 12-amino-acid protein C-derived epitope tag was inserted in-frame within gK domain III at a site predicted not to significantly affect the secondary structure of gK (Fig.1D).

The recombinant gK gene coding for the epitope-tagged gK was constructed using PCR-based splice-overlap extension methodology as described previously (6,10, 11) and cloned into plasmid pSJ1723, generating plasmid pTF9301 (Fig. ICP4 has also been shown to have anti-apoptotic functions [125,126]. This plasmid contained gK-flanking sequences corresponding to the UL52 and UL54 (ICP27) genes to facilitate homologous recombination with viral DNA (21). Recombinant virus gKprotC-DIII was constructed by rescuing the mutant virusd27-1(KOS) (36), which has a lethal deletion within the UL54 gene specifying the immediate-early protein ICP27 as shown previously (9, 10, 21) (Fig. The replication of CCV DNA in CCOBr cells over time or in the presence of acyclovir (ACV) (Sigma Chemical Co., St. Putative recombinant virus isolates were plaque purified and tested by PCR and DNA sequencing for the presence of contaminating d27-1 virus and the engineered epitope-tagged gK (not shown). Construction of recombinant virus gKprotC-DIII, specifying gK containing a protein C epitope tag.

Cells were overlaid with 2 ml of a 1:1 mixture of low-melting-temperature agarose (SeaPlaque agarose; Biowhittaker Molecular Applications, Rockland, Maine) and 2× Dulbecco’s modified Eagle medium to allow only cell-to-cell spread of virus. (B) Shown below is the region of the mutant virus HSV-1d27-1 genome (between map units 0.7 and 0.8) containing the UL52, UL53, and the partially deleted UL54 open reading frames (shaded and boxed regions of the UL54 gene pointed to by an arrow) with relevant restriction endonuclease sites. (C) Plasmid construct, pTF9301, containing the recombinant gK-protC gene and flanking UL52 and UL54 sequences used to generate recombinant virus gKprotC-DIII. (D) Schematic model of the predicted secondary structure of gK (10). For the type-common and HSV-2 ELISA assays, serum samples were diluted to 1/100, and for the HSV-1 ELISA, serum samples were diluted to 1/50 for further titration. The degree of stability of regions containing the reiterated sequences (hypervariable regions) of the S component of the HSV-1 genome was previously examined, and reiterations IV and VII were proposed to be sensitive and convenient markers for the differentiation of HSV-1 isolates (Maertzdorf et al. The primary structure of the epitope tag is shown.

Known syncytial mutations are denoted by asterisks. The lacZ cassette extends from a NotI site 105 bp from the 5′ end of UL17 to an XhoI site 516 bp from the 3′ end of UL17 and is transcribed in the opposite direction from UL17 transcription. Viral plaques were visualized by phase-contrast microscopy and photographed. Recombinant virus gKprotC-DIII produced viral plaques that were morphologically similar to KOS plaques (Fig. DNA synthesis starts as early as 3 hours p.i. Comparison of plaque morphology and replication characteristics of gKprotC-DIII and KOS viruses. Comparison of virus plaque morphologies formed on Vero cells at 48 h postinfection.

Positive plaques were excised and bacteriophage was eluted. (B) gKprotC-DIII. (C) Time-dependent kinetics of infectious virus production after infection of Vero cells at an MOI of 5 and incubation at 37°C. RNA was transferred to NYTRAN SuperCharge filters (Schleicher and Schuell, Keene, N.H.) and UV cross-linked. Each separate experiment was repeated in triplicate to obtain standard deviations. For analysis of one-step growth kinetics, each virus at a multiplicity of infection (MOI) of 5 was adsorbed to approximately 8 × 105 Vero cells at 4°C for 1 h. Thereafter, warm medium was added, and virus was allowed to penetrate for 2 h at 37°C.

Three overlapping oligonucleotide pairs were used as primers for complete gG-1 gene sequencing as described previously (26). A number of deletions and multiplications were identified; however, no frame-shift mutation was present. Virus titers were determined by titration on Vero cells. The gKprotC-DIII virus replicated as efficiently as the KOS parental strain in Vero cells (Fig. Proteins were separated on denaturing polyacrylamide gels and were either stained with Coomassie blue or electrically transferred to a polyvinylidene difluoride membrane, stained with sulforhodamine, and digested with trypsin, as described previously (13, 24). These results indicated that insertion of the 12-amino-acid protC epitope tag within gK domain III did not adversely affect the structure and function of gK with regard to virus replication and cell-to-cell spread. Detection and characterization of gK specified by gKprotC-DIII using anti-protC MAb.Subconfluent Vero cell monolayers were infected with either gKprotC-DIII or KOS at an MOI of 5.

Later in infection, VP5 and some tegument proteins accumulate in intranuclear regions separate from the DNA replication compartments, the so-called assemblons [196]. Insoluble cell debris was pelleted, and samples were electrophoretically separated by sodium dodecyl sulfate–10% polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes (9). Blots were probed overnight with anti-protC MAb HPC-4 at 1:50 dilution (ATCC CRL HB-9892). 1B). All antibody dilutions and buffer washes were performed in TBS supplemented with 0.135 M CaCl2 and 0.11 M MgCl2. MAb HPC-4 detected gK protein species ranging from approximately 36 to 43 kDa, with the predominant species migrating with an apparent molecular mass of approximately 36 kDa. gE-specific siRNA treatment of HaCaT cells demonstrates a reduced plaque size with WT HSV-1 infection, similar to that observed with gEnull virus.

In contrast, antibody HPC-4 did not react against extracts derived from KOS-infected cells (Fig. 3A). Similar to other herpesvirus glycoproteins, these results show that the protC-tagged gK exists as multiple protein species in virus-infected cell extracts. When the 108 HSV-1 isolates were investigated for reactivity using an anti-gG-1-specific MAb by ELISA on infected GMK cells, 42 clinical isolates showed no reactivity, and these strains were derived from different anatomical sites (Table ). 2006 ). Cellular extracts were treated with Endo-H (lanes 2 and 5), PNGase-F (lanes 3 and 6), or mock treated (lanes 1 and 4). (C) Cellular extracts obtained from Vero cells infected with gKprotC-DIII in the presence (lanes 2 and 4) or absence (lanes 1 and 3) of TM were probed with either anti-protC MAb (lanes 1 and 2) or anti-gD MAb (lanes 3 and 4).
American Society for MicrobiologyJournal of Virology

). Thus, the gK-related species with molecular masses of 36 to 43 kDa represent glycosylated gK derivatives. The 25-kDa protein could be either a proteolytically processed peptide or a previously predicted gK-related protein, which may be produced by an alternate transcript utilizing an initiation codon within the UL53 ORF (29). The ability of HSV-1 to remain latent in sensory neurons innervating the primarily infected cells for the lifetime of the host is a unique property and is thought to mediate the perpetuation of the virus in the human population. To characterize the carbohydrate character of gK, Vero cell monolayers were infected with gKprotC-DIII at an MOI of 5 and incubated in the presence or absence of 5 μg of tunicamycin (TM) per ml. Cellular extracts were prepared at 48 h postinfection and analyzed by SDS-PAGE and immunoblot analysis using either anti-protC antibody, HPC-4, or anti-gD antibody 1103 (Rumbaugh-Goodwin Institute, Plantation, Fla.) (Fig. Identification of a CCV IE gene.To identify and clone CCV IE genes, a cDNA library was constructed from cycloheximide-restricted CCV-infected CCO cells.

In the presence of TM, gK had an apparent molecular mass of approximately 32 kDa, which corresponded to the predicted molecular mass of the unglycosylated gK after removal of the signal peptide (Fig. 3C, lanes 1 and 2). The median plaque area (square) is shown ± SD (error bars) for WT HSV-1 alone, sigE-transfected and WT-infected cells, siCRK-transfected and WT-infected cells, and cells infected with the gEnull HSV-1. As expected, TM reduced the apparent molecular mass of gD from 59 to 50 kDa (Fig. 3C, lanes 3 and 4) (41). To further investigate the glycosylation of gK, infected cellular extracts were mock treated or incubated in the presence of either endoglycosidase H (Endo-H) or peptide:N-glycosidase F (PNGase F). When five putative recombinants were excluded, the bootstrap value was in fact 100% (not shown).

A 4-bp sequence, “TCCC” (nucleotide no. Samples were subsequently incubated for 18 h at 42°C either with 50 mM sodium citrate (pH 5.5) and 100 U of Endo-H (NEB Labs, Beverly, Mass.) for Endo-H digestions, with 50 mM sodium phosphate (pH 7.5), 1% NP-40, and 20 U of PNGase-F (NEB Labs) for PNGase-F digestions, or without enzyme prior to SDS-PAGE and Western blot analysis. PNGase-F treatment, which cleaves off all N-linked carbohydrate chains from the protein backbone, reduced the apparent molecular mass of gK from 36 to 32 kDa (Fig. , lane 1) and in HSV-1(R7224) DNA (lane 2). 3C, lane 2). Endo-H treatment, which is specific for digestion of high-mannose carbohydrate chains, resulted in the production of multiple protein species migrating with apparent molecular masses of 36, 34, 32, and 25 kDa. In cell culture, LAP2 is primarily active following viral DNA synthesis and, hence, responsible for LAT expression during lytic infection [257].

3A, lane 2). As controls for the PNGase F and Endo-H activities, the effect of these enzymes on gD specified by either gKprotC-DIII or KOS was also assessed. (Fig. 3B). These results are consistent with previous reports that suggested gK is expressed predominantly as a high-mannose glycosylated species (19). The effect of sigE treatment upon WT HSV-1 protein expression was determined next by flow cytometry. gK is a structural component of purified virions.Previous reports suggested that HSV-1 gK might not be a structural component of virions (19).

However, studies with PRV and VZV demonstrated that gK was present in purified virions. To ascertain whether gK was a structural component of HSV-1 virions, we investigated whether gK specified by gKprotC-DIII could be detected in purified virions. This seronegativity to gG-1 was considered to be due to samples being collected during early seroconversion in seven cases. Predictor variables were the set of 20 RFLPs, which were distributed widely on the L component of HSV-1 DNA (Umene and Yoshida 1993). Forty-eight hours postinfection, supernatants containing extracellular virus were harvested, and cellular debris was removed by centrifugation at 10,000 × g for 15 min. Virus was concentrated by pelleting through a 10% sucrose–TBS cushion at 100,000 ×g for 1.5 h. To ensure that the phenotype attributed to HSV-1(UL17-stop) was due to the mutation in the UL17 gene, cells were (i) transfected with plasmid pJB114, delimited by a SacI site near the 5′ end of UL16 and a SacI site within UL17 (a schematic diagram of this fragment is shown in Fig.

Purified virus was collected from the light-scattering phase midway through the gradient, diluted threefold in TBS, and layered on a 10%–30%–60% sucrose–TBS discontinuous step gradient. Purified virion preparations were collected by side puncture at the 30%–60% interface, diluted in 30 ml of TBS, layered onto a 10% sucrose–TBS cushion, and centrifuged at 100,000 × g for 1.5 h to concentrate the virion preparations. Viral proteins were extracted and processed in MPER-protease inhibitor cocktail as described for cell lysates. Antibody HPC-4 detected gK in gKprotC-DIII purified virions, while it did not react with KOS purified virions (Fig.4A). Treatment of purified virions with PNGase-F caused the appearance of a gK species migrating as a 32-kDa band similar to that observed in PNGase-F-treated cellular extracts (compare Fig. 1C. 4A, lane 3).

The 25-kDa species observed in cellular extracts was not detected in immunoblots of purified virion preparations. 4c) gD protein expression. 4A, lane 2). Detection and characterization of protC-tagged gK expressed on purified virions. Immunoblots of gKprotC-DIII (lanes 1 to 3) or KOS (lanes 4 to 6) purified virion preparations reacted with anti-protC MAb HPC-4 (A), anti-gD MAb 1103 (B), and anti-ICP27 MAb 1113 (C). to differ among type 1 strains (1). Each deletion on the region encompassing reiteration VII was assumed to have been generated in an ancestor virus with a set of RFLPs, and the deletions generated were assumed to be transmitted to progeny, as well as the set of RFLPs, thereby maintaining a correlation between the set of 20 RFLPs and “deletion” on the region encompassing reiteration VII.

Cellular extracts were treated with Endo-H (lanes 2 and 5), PNGase-F (lanes 3 and 6), or mock treated (lanes 1 and 4). For control purposes, parallel immunoblots were assayed for the presence of gD and ICP27. Viral DNAs were purified and were digested with BamHI. 4B). HSV-1 (UL54) ICP27 is a known nonstructural protein, which is expressed in infected cells but is not present in purified virions (45). As expected, ICP27 was detected in gKprotC-DIII- and KOS-infected cell extracts using anti-ICP27 antibody 1113 (Rumbaugh-Goodwin Institute); however, it was not present in purified virions (Fig. 4C and D).

HSV-1 gK enhances virion entry.Based on the finding that gK was present in purified virions and the fact that syncytium mutations in gK alter virus entry kinetics (31) as well as cause substantial virus-induced membrane fusion (2, 8), we examined the penetration kinetics of the ΔgK virus in comparison to its parental strain, KOS. The time of viral DNA replication was determined by analyzing [3H]dT incorporation in CCV-infected CCOBr cells, using lysates collected from 0.5 to 16 h p.i. The inoculum was subsequently removed, warm medium (34°C) was added, and the cultures were shifted to 34°C to allow virus penetration. Immediately thereafter (0 h) and at 30, 60, 120, and 180 min, remaining extracellular virus was inactivated by treatment with low-pH buffer (0.1 M glycine, pH 3.0). The HaCaT monolayer was transfected with 70 nM (a), 10 nM (b), and 5 nM (c) sigE and then infected with 25,000 PFU of WT HSV-1. Virus plaques were counted at 48 h postinfection, and the percentage of PFU surviving low-pH inactivation compared to PBS-treated controls was calculated. The kinetics of ΔgK (gK−/−) virion entry was substantially reduced in comparison to the KOS (gK+/+) strain.

Furthermore, ΔgK virions produced in the complementing cell line, VK302 (gK−/+), which is transformed with the gK gene (18), entered substantially faster, exhibiting entry kinetics similar to that of the KOS virus (Fig.5). Both genetic variants were proportionally isolated from females and males and were present at all of these different body regions with the possible exception of extralabial and facial manifestations, where none of five isolates were MAb negative. HSV-1 is thought to have co-migrated and diversified with its human host (Bowden et al. Mean values and standard deviations of three independent experiments are shown. Considering the importance of gK in membrane fusion phenomena, it is not surprising that gK was found to be glycosylated by the Golgi apparatus as well as being a structural component of the virion that functions to enhance virion entry. , lane 7), end-specific BamHI S fragments were readily detected. ΔgK virions have a major defect in virion egress, which causes the accumulation of virions within vesicles in the cytoplasm of infected cells.

The origin of these vesicles is not yet known; however, morphological data suggest that they may be derived from the Golgi complex. If this is true, it may mean that gK functions in a Golgi complex-dependent pathway involved in either reenvelopment at the Golgi complex according to the deenvelopment/reenvelopment model (4,13, 14, 40, 44) or post-Golgi complex transport of virions to extracellular spaces. It is important to note that lack of gK is not absolutely lethal for virus replication in cell culture, although it does reduce virus titers by more than 100-fold and substantially reduced the kinetics of virus entry into Vero cells. Importantly, experimental infections in mice using the eye route indicate that gK may be required for virus replication, spread, and neurovirulence in vivo (unpublished data). (B) Riboprobes designed to detect ORF39 and ORF46 (see Fig. In this regard, more sensitive cell culture systems and experimental animal studies may be required to delineate the functions of gK. This work was supported by a grant from the National Institute of Allergy and Infectious Diseases (AI43000) to K.G.K.

Low concentrations of certain siRNAs can produce large levels of nonspecific effects, and high concentrations of others have little nonspecificity (P.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Related Terms 3 H-lysine, [3H]lysine, 5-hydroxy-L-lysine, [6-14]lysine, 14C-lysine, 15A8-glycyl-tyrosyl-(N-epsilon-diethylenetriamine pentaacetic acid)-lysine, 15N-lysine, 24-h [13C]leucine, 320 lysine, 373 lysine, acetone/periodate-lysine-paraformaldehyde (PLP), AGEs, alginate-pectin-poly-L-lysine, alginate-poly(L)lysine-alginate membrane, alpha-N-acetyl-L-lysine anilides, alpha-N-acetyl-L-lysine methyl ester, alpha-N,N-bis[carboxymethyl]lysine, amino acid anabolism, amino acids, B lysine residue, bendazac lysine, beta 2 132 lysine, beta 59 (E3) lysine, beta 144 (HCl) lysine-asparagine, beta-lysine, bis-L-tyrosinyl-L-lysine, C6H14N2O2, carbocysteine lysine salt, carboxyethyl lysine, carboxyethyl-lysine, carboxyethyllysine, carboxymethyl lysine, carboxymethyl-lysine, carboxymethyllysine, carboxy-terminal lysine, cdc2 lysine 33, cefuroxime lysine, CEL, CML, C-terminal lysine, dansyl lysine, decarboxylate lysine, desglycinamide lysine vasopressin, di-lysine, dipalmityl lysine group, DNA-lysine, E-N-trimethyl-lysine, epsilon-amino-carbamoyl-lysine, epsilon-diaminocaproic acid, epsilon-DNP-lysine, epsilon(gamma-glutamyl) lysine, epsilon-lysine (poly)peptides, epsilon-N-DL-trimethyl-lysine, epsilon-N(L-furoylmethyl)-L-lysine, epsilon-N-methyl lysine, epsilon-N-trimethyl-lysine, furosine, galactosylated poly-L-lysine, glutamic acid-lysine (EK), glycyl-L-histidyl-L-lysine, H3-lysine, H-D-valyl-L-leucyl-L-arginine 4-nitroanilide, H-D-valyl-L-leucyl-L-lysine 4-nitroanilide, hippuryl-lysine, histone H3 lysine 9, histone H3 lysine 27, histone lysine methyl transfer, homocitrulline, isopeptide, ketoprofen lysine, L-[1-13C]lysine, L-[13C1]lysine, L-[15N2]lysine, lactosylated poly-L-lysine, L-[alpha-15N]lysine, LC, L-lysine, L-lysine amidotrizoate, L-lysine diatrizoate, L-lysine monohydrochloride, L-lysine-alpha-oxidase, L-N6-(1-iminoethyl)lysine, LVP, Lys, Lys-5, Lys-33, (Lys-43), Lys-60f, Lys-63 polyUb chains, Lys-77, Lys-122, Lys-128, Lys-129, Lys-156, Lys-192, Lys-234, Lys-236, Lys-284, Lys-286, Lys-287, Lys K, lysine analog (MK-521), lysine analogs [aminocaproic acid and tranexamic acid], lysine epsilon-amino groups, lysine palmitoylation, lysine residue 162, lysine residue 340, lysine salt, lysine (solusprin), lysine-5, lysine-8-vasopressin, lysine-20, lysine-29, lysine-41, lysine-43, lysine-48, lysine-49 phospholipase A2, lysine-49 phospholipase A2 isoform, lysine-50, lysine-54, lysine-60f, lysine-63, lysine-70, lysine-72, lysine-75, lysine-77, lysine-79, lysine-92, lysine-121, lysine-125, lysine-134, lysine-149, lysine-156, lysine-158, lysine-160, lysine-182, lysine-183, lysine-185, lysine-192, lysine-199, lysine-204, lysine-205, lysine-271, lysine-304, lysine 405, lysine-416, lysine-460, lysine-532, lysine-539, lysine-743, lysine-851, lysine-893, lysine-950, lysine-acetyl salicylate, lysine-acetylsalicylate (L-ASA), lysine-acetylsalicylic acid, lysine-aminopeptidase, lysine-clonixinate (CAS 55837-30-4), lysine-decarboxylase, lysine-fosfomycin, lysine-gingipain protease (Kgp), lysine-hydrochloride, lysine-hynic conjugate Fmoc-N-epsilon-(Hynic-Boc)-Lys, lysine-ketoglutarate, lysine-MDA [3-(N epsilon-lysino)propan-1-ol (LM)], lysine-MDA-lysine iminopropene cross-link [1,3-di(N epsilon-lysino)propane (LML) and lysine-HNE [3-(N epsilon-lysino)-4-hydroxynonan-l-ol (LHNE)], lysine-monohydrochloride, lysine-para-isobutylphenyl propionate, lysine-phenylalanine-glutamate-arginine-glutamine (KFERQ), lysine-p-isobutylphenylpropionate, lysine-p-isobutyl-phenylpropionate, lysine-salicylate, lysine-sepharose, lysine-sepharose 4B, lysine-specific cysteine proteinase, lysine-theophylline, Lys-plasminogen, lysyl oxidase, lysyl-L-lysine, mafosfamide lysine (ASTA-Z 7654), malondialdehyde-lysine, (MDA-lysine), MDP-Lys (L18), methylated lysine, methyl-lysine marks, metrecal arginine lysine, muroctasin, N-acetylglycyl-lysine methylesterhydrolase, N2-acetyl-N6-dinitrophenyl-lysine, N2-/(N-acetylmuramoyl)-L-alanyl-D-isoglutaminyl/-N6-stearoyl-L-lysine(MD P-Lys (L18)), N6-(iminoethyl)-L-lysine, N15 lysine, N(alpha)-(5′-phosphopyridoxyl)-L-lysine, N-alpha-benzyloxycarbonyl-L-lysine thiobenzyl ester (BLT), N-alpha-benzyloxycarbonyl-L-lysine thiobenzyl ester serine esterase, N-alpha-Fmoc-L-lysine, N-alpha-(gamma-aminobutyryl) lysine, N-alpha-p-tosyl-L-lysine chloromethylketone, N-alpha-triglycyl-(8-lysine)-vasopressin and 8-lysine-vasopressin, N-(epsilon)-(1-carboxyethyl)lysine, N-epsilon-(carboxyethyl)lysine (CEL), N-epsilon-(carboxymethyl)lysine (CML), N-epsilon-gamma-glutamyl lysine, N-(epsilon)-(gamma-glutamyl)lysine isodipeptide, N-(epsilon)-(gamma-L-glutamyl)-L-lysine (GGEL), N-epsilon-methylated lysine, N-epsilon-[(R)-1-carboxyethyl]-L-lysine (alaninolysine, AlaLys), N-(epsilon)-[(R)-1-carboxyethyl]-N(alpha)-(D-galacturonoyl)-L-lysine, N-iminoethyl-L-lysine, negative lysine decarboxylase, peptidyl lysine, periodate-lysine-paraformaldehyde (PLP), phenylalanine-2-lysine-8-vasopressin, p-isobutylphenylpropionate of lysine, PLL, PLP, poly-alpha-lysine (alpha-PL), poly-D-lysine, poly(epsilon-L-lysine), poly-epsilon-lysine (epsilon-PL), polyinosinic-polycytidylic lysine carboxymethylcellulose (poly(ICLC)), poly-L-lysine, poly(L-lysine), poly-L-lysine polymers, poly(L-lysine)-diethylenetriaminepentaacetic acid carrier, polylysine, polyriboinosinic-polyribocytidylic acid-poly-L-lysine complex (poly(ICL)), pronyl-lysine, RN-56-87-1 (lysine), rociverin-lysine acetylsalicylate, (S)-2,6,-diaminohexanoic acid, sepharose-L-lysine, strepronine-lysine salt, tetracyline-L-methylene lysine (Tetralysal), tetra-L-lysine, thiolated poly-L-lysine (PLL), triglycyl lysine vasopressin (glypressin), valyl-leucyl-lysine 4-nitroanilide, xylose lysine desoxycholate agar. Research shows that taking relatively high doses of L-lysine on a regular basis can increase the length of time between herpes outbreaks and hasten healing time. The terms lysine and L-lysine are used interchangeably throughout. It is also incorporated into the 57-kDa protein expressed by the amino-terminal PK expression vector. The peptide backbone, composed solely of both epitopes, was extended by N-terminal attachment of one (PAM-Th-CTL), two [(PAM)2-Th-CTL], or three [(PAM)3-Th-CTL] palmitoyl lysines and delivered to H2b mice in adjuvant-free saline. Lysine is considered an “essential” amino acid because it cannot be created by the body. Genital Herpes: Symptoms Causes and Treatment Genital herpes is a condition that manifests when the herpes simplex virus HSV enters the body through some direct contact with herpes sores sexually or otherwise.
American Society for MicrobiologyJournal of Virology

Common dietary sources of lysine include meat, fish, dairy, eggs, soy, and legumes. The rational of the molecularly defined vaccine approach presented in this study may be applied to ocular herpes and other viral infections in humans, providing steps are taken to include appropriate Th and CTL epitopes and lipid groups. ↵*Corresponding author. L-lysine is also the only form that is active within the body. Complete healing of all herpes symptoms by the third treatment is similar in HIV-infected and HIV-uninfected patients. Early research also suggests that lysine may promote calcium metabolism and bone formation, as well as aid in the treatment and prevention of herpes simplex virus. Fax: (714) 456-5073.

E-mail: Lbenmoha{at}uci.edu.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology
Herpes simplex virus type 1 (HSV-1) encodes 11 envelope glycoproteins, of which glycoprotein G-1 (gG-1) induces a type-specific antibody response. However, clinical isolates which are deficient in such proteins occur rarely. Composite trees were constructed starting with the top-scoring tree based on the broadest set of genes and supplemented by addition of virus species from trees based on narrower gene sets, to give finally a 46-species tree; branching order for three regions within the tree remained unresolved. γ34.5 mutants fail to grow on a variety of human cells as phosphorylated eIF2 accumulates and protein synthesis ceases prior to the completion of the viral life cycle. Mutation is the major source of genetic change in viruses. A consolidated VZV genotyping scheme employing the origin-associated region between reiteration region R4 and open reading frames (ORFs) 63 and 70 is described, one which accurately categorizes strains into one of four clades related to the geographic origin of the isolates. Izumi, and J.

Mailing address: Department of Microbiology and Kaplan Comprehensive Cancer Center, New York University School of Medicine, 550 First Ave., MSB 214, New York, NY 10016. The prototype VZV sequence contains nearly 125,000 bp, divided into 70 open reading frames. HSV-2 is sexually transmitted; it typically infects the genital mucosa and establishes a lifelong infection in the sacral ganglia. Nucleotide sequences and annotations of unique and repeated regions are derived from NCBI RefSeq records as follows: VZV strain Dumas (accession number NC_001348), HCMV strain Merlin (NC_006273), EBV strain B95-8 (NC_007605), and KSHV strain GK18 (NC_009333).

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Kaposi’s sarcoma-associated herpesvirus (KSHV) is etiologically associated with Kaposi’s sarcoma (KS), primary effusion lymphoma (PEL), and multicentric Castleman’s disease. We have previously shown that KSHV utilizes the host transcription factor Nrf2 to aid in infection of endothelial cells and oncogenesis. Gotleib-Stematsky, eds.), Marcel Dekker, New York, pp. Using a consensus prediction approach, we identified 16 new CD4 epitope-specific responses that arise during lytic infection. Nrf2 inhibition by the chemical brusatol also induces lytic gene expression. This morphologically apparent LANA1 dispersion correlates to loss of viral episome by molecular analysis. Additionally, the transcription of RTA correlates with LANA expression in the early stages of de novo infection of KSHV, and induction of LANA transcription is responsive to induction of RTA with an inducible system.

American Society for MicrobiologyJournal of Virology
In late-stage KS or primary effusion lymphoma, the latent form of the virus predominates and drives the proliferation and survival of the tumor cells. We also show that there are two faces to LANA and have identified a positively charged patch on the dimer surface opposite to the DNA binding region and found this patch exerts an important role in the virus’s ability to expand latent infection in vivo. LANA may therefore promote chromosomal instability by suppressing the functional activities of p53, thereby facilitating KSHV-mediated pathogenesis and cancer. Kaposi’s sarcoma-associated herpesvirus (KSHV), also referred to as human herpesvirus 8, primarily infects endothelial and B cells, persisting episomally in these latently infected cells (7, 44). R. KSHV infection in tumor cells and in primary effusion lymphoma cell lines is predominantly latent. We identify 16 new epitopes during acute infection that promote cytokine-producing CD4 T cell responses.

LANA in particular plays a key role in the maintenance of latency. The spindle-shaped proliferating endothelial cells, considered a hallmark of KS lesions, harbor the KSHV genome in a latent state. Virion binding to cell surface receptors also triggers signal transduction pathways, which may facilitate viral entry. Silencing annexin A2 in BCBL-1 cells resulted in significant cell death, downregulation of cell cycle-associated Cdk6 and of cyclin D, E, and A proteins, and downregulation of LANA-1 and ANG expression. Presumably these repression functions help negate the cellular antiviral response, overcome cell cycle checkpoints, and possibly suppress transcription of viral lytic genes. Here, we investigate the role of Nrf2 in PEL and demonstrate that Nrf2 plays an important role in KSHV gene expression, lytic reactivation, and cell survival by interacting with the host transcriptional repressor KAP1 and the viral latency-associated protein LANA-1 to mediate global lytic gene repression and thus cell survival. KSHV infection reprograms the host cell’s transcriptional machinery to create an environment that is conducive for its latent intracellular parasitism (14, 30).

In addition, an alternative downstream promoter for a transcript that expresses vmiRNAs and K12 has been identified (13). 2015. Activated Nrf2 interacts with Kaposi’s sarcoma-associated herpesvirus latency protein LANA-1 and host protein KAP1 to mediate global lytic gene repression. J Virol 89:7874–7892. Several authors have assumed these bands represent degradation products of the major 226- to 234-kDa isoforms (27, 28), but this has not been demonstrated.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology
Chemokines are inflammatory molecules that act primarily as chemoattractants and as activators of leukocytes. Boyd, and T.-C. The vaccine elicited antibody and cell-mediated immunity (CMI) in the 15 subjects without past evidence of HSV infection and this response was similar to that observed after a natural infection. Juvenile diabetes is such an illness. 70:508–519, 1996). Progress in the field of DNA vaccination has resulted in the development and the marketing of three veterinary DNA vaccines[23]. This was evident after BHV-1 challenge when high levels of both immunoglobulin G (IgG) and IgA were detected.

A problem limiting the effectiveness of some DNA vaccines, however, is that they do not sufficiently stimulate the immune system. Moreover, of the Th1-type cytokine genes tested, IL-12 was a particularly potent adjuvant for the gD DNA vaccination. While these early studies have only just begun to provide suggestions of vaccine efficacy, the concepts brought forth by DNA vaccines have dramatically changed the way many investigators in the basic sciences are approaching their work. These ideas, which are relevant to our subsequent discussion of how DNA vaccination induces CD8 T cells, have been reviewed elsewhere,19 and detailed molecular, immunological, and biological perspectives are available.20 The underlying mechanisms are cartooned in (the molecular details of the antigen presentation pathways are described in other chapters in this volume). Because routine vaccination is almost always applied to large populations, direct (in vivo) gene transfer would be the method of choice for prophylactic immunization purposes. Fax: (215) 573-9436. E-mail:dbweiner{at}mail.med.upenn.edu.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology
Kaposi’s sarcoma-associated herpesvirus (KSHV), the most recently identified member of the herpesvirus family, infects a variety of target cells in vitro and in vivo. The invasion of host cells by a large range of RNA viruses is inhibited by IFITMs during the entry step. Thus, the balance between cellular repressors and virus-counteracting proteins determines whether or not a cell becomes productively infected. One aspect of intrinsic resistance to herpes simplex virus type 1 (HSV-1) is conferred by components of PML Nuclear Bodies, which respond to infection by accumulating at sites that are closely associated with the incoming parental HSV-1 genomes. We also confirm suppression of hepatitis B virus and poliovirus by ARB. When monolayers of 293T BAC36 and 293T BAC-stop45 cells were induced with 12-O-tetradecanoylphorbol-13-acetate and sodium butyrate, no significant difference was found between them in overall viral gene expression and lytic DNA replication, but induced 293T BAC-stop45 cells released 10-fold fewer virions to the medium than did 293T BAC36 cells. Remarkably, in fact, with lymphocytic choriomeningitis virus during the acute phase, lymphocytic choriomeningitis virus-specific CD8+ T cells reach 70% of the total CD8+ population and represent as many as 50% long into the memory phase.

The odds of achieving an aborted episode were 1.93 (95% CI: 1.28 to 2.90) times higher for those initiating treatment with valaciclovir within 6 hours of first sign or symptom. According to a study by Pew Research, 25% of young women have been sexually harassed online, and 26% have been stalked. Additional studies revealed that neurons expressing the glucocorticoid receptor also expressed bICP0 or VP16 at 1.5 h after dexamethasone treatment. This demonstrates the importance of pUL36 in the initial stages of tegument addition and provides new insights into the process of virus particle assembly. These studies provide evidence that VP16 and the promiscuous viral trans-activator (bICP0) are expressed during the escape from latency, suggesting they promote the production of infectious virus in a small subset of latently infected neurons.

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

The varicella-zoster virus major transactivator, IE62, contains a potent N-terminal acidic transcriptional activation domain (TAD). Using the yeast two-hybrid system, we found that VZV IE63 interacts with human antisilencing function 1 protein (ASF1). VZV ORF32 protein was shown to be phosphorylated and located in the cytosol of virus-infected cells. Morrow, A. Shade, B. Two deletion mutants mapped a gE binding region in gI to residues 105 to 125. Southern analysis showed that cells infected with parental VZV (VZVLUC) or a repaired virus (30R) contained DNA termini, whereas cells infected with Δ30L, 30-IXAla, 30-620A, or 30-622A contained little or no processed viral DNA.

The type of cells and the signal pathways involved in varicella virus infection remain unclear, and more evidence is needed. Thus, the unique short region VZV kinase has important cell-type-specific functions that are separate from those affecting IE62 and apoptosis. Virus reactivation, usually many decades later, results in shingles (zoster). Clinical observations indicate that primary VZV infection begins with respiratory mucosal inoculation and that the characteristic chickenpox rash develops after an incubation period of 10 to 21 days (3, 9). Clinically, herpes zoster is characterized by severe acute pain and a dermatomal rash and often by prolonged neurologic signs and symptoms (12). The VZV genome (∼125 kb) encodes nine putative glycoproteins, which are known or presumed to contribute to the different steps of VZV replication: attachment and entry into the target cell, envelopment of the viral particles, cell-cell spread, and egress (8). Glycoprotein E (gE), the product of open reading frame 68 (ORF68), is a 623-amino-acid (aa) type I membrane protein that is essential for viral replication (34, 40) and involved in cell-cell fusion and secondary envelopment (3, 9, 35, 36, 50, 53).

gE, which is conserved among the alphaherpesviruses, is the most abundant glycoprotein expressed in VZV-infected cells (19). performed research; C.D.J. Alteration of the proper gE trafficking during VZV infection by deletion of the cytoplasmic C-terminal domain or mutation of the endocytosis motif, YAGL, located in this region had lethal effects (43); this motif mediates recycling of gE from the plasma membrane to the TGN, the site of secondary envelopment (17, 38, 49, 65). The cytosolic domain is important in the regulation of gE trafficking and secondary envelopment in other alphaherpesviruses, as well (5, 15, 16, 37, 59). As we have reported, VZV gE differs from its homologues in the alphaherpesviruses because the extracellular domain of VZV gE (aa 1 to 544) contains a large nonconserved N-terminal region (aa 1 to 188). These observations led to this analysis of the effects of VZV on the expression and intracellular fates of proteins in the NF-κB pathway, which was of particular interest because other herpesviruses, including the related alphaherpesviruses herpes simplex virus type 1 (HSV-1) and HSV-2, elicit sustained NF-κB activation. A single amino acid change in the N-terminal region (D150N) of the spontaneously occurring VZV mutant VZV-MSP has been shown to accelerate cell-cell spread in vitro and in vivo (53), further indicating the involvement of the unique gE N-terminal region in VZV-induced cell fusion.

Interestingly, the unique gE N-terminal domain has been recently shown to bind to the cellular protein insulin-degrading enzyme (IDE) (31); this interaction has been reported to have functions in VZV entry and cell-cell spread (30). As in the other alphaherpesviruses, VZV gE forms noncovalent heterodimers with gI (ORF67). Transcription, and in some cases, translation, of VZV ORFs for IE genes 4, 62, and 63, as well as early and late genes that encode ribonucleotide reductase (ORF18), nucleocapsid proteins (ORF21 and ORF40), DNA binding protein (ORF29), and viral kinase (ORF66), has been reported in human DRG from autopsies, although observations about specific VZV genes have varied (7-10). Deletion or mutation of gI affected gE conformation and cellular localization and disrupted the extensive syncytium formation that is the hallmark of VZV replication (7, 34, 40). Importantly, whereas gI is dispensable for VZV replication in vitro, studies with the SCIDhu mouse system (44, 63) showed that gI is essential for VZV infection of human skin and T cells (21, 42). Surprisingly, while gI is important for the pathogenesis of VZV infection of human dorsal root ganglion (DRG) xenografts, it is not essential for viral replication and cell-cell spread in human neurons and satellite cells in vivo (64). ORF47 and UL13 are evolutionarily similar to CKII, although only the cellular enzyme is inhibited by heparin (10, 26, 27).

Formation of the HSV gE/gI heterodimer contributes to the sorting of nascent virions to the lateral surface in epithelial cells and cell-cell spread (10-13, 24, 51, 59). The HSV gE/gI complex, as well as gD, is also involved in secondary envelopment of cytoplasmic virions in the TGN (14). HSV gE/gI on the lateral surfaces of epithelial cells colocalized with the adherent junction component β-catenin, but not with ZO-1, a protein of the tight junction (13). Carrier plasmid (pUC19) was added so that the total amount of DNA transfected was constant. The surface molecules are so similar to the human cell surface that in this process some human cells combine into a syncytium, which includes the material from many cells with multiple nuclei. Human fetal DRG can be maintained for eight weeks as xenografts under the kidney capsule of SCID mice [14], and the virus gene expression profile at eight weeks post-infection in DRG xenografts is comparable to latently infected adult trigeminal ganglia; however, difficulties in maintaining viable DGR xenografts along with ethical concerns regarding fetus-derived tissue has limited their widespread utilization. To generate MeWo cells stably expressing VZV gM (designated MeWo-gM cells), a plasmid encoding hemagglutinin (HA)-tagged VZV gM was constructed.

In addition, many proteins enter the nucleus by piggybacking onto other proteins that harbor an NLS. This region contains 4 of the 10 gE extracellular cysteines. (A) Schematic of the IE62 truncations fused to the Gal4 DBD. Poustovoitov, unpublished data). The two clones were then cut with AgeI and AatII, and the mutated DNAs were inserted into theNotI plasmid. Virus and cells.VZV strain Schenke, a low-passage-number clinical isolate, was propagated in human foreskin fibroblasts (HFFs). qPCR and data analysis.Herein, we adhered to recently proposed guidelines concerning the minimum information for publication of quantitative real-time PCR experiments (MIQE) (2).

These studies imply that serine and threonine residues in the cytoplasmic domain of gI might be required for the function of gI and, potentially, the formation of the gE/gI heterodimer. A repaired Δ30L virus (30R) was isolated by replacing galK with the parental ORF30 gene. The fixed and permeabilized cells were then stained with sheep Abs specific for human IFN-α (Endogen, Inc., Woburn, MA, USA). Furthermore, while cells infected with VZV expressing inactivated ORF66 show higher levels of apoptosis in PCF cells, this does not account for the failure of ORF66 kinase-negative VZV to replicate in this cell type. Samples were also treated with RNase (40 μg/ml) for 30 min at 37°C. Within 24 h after adoptive transfer, CD3 T cells were detected within the epidermis and dermis and around the hair follicles in skin tissues. Protein A conjugated to 15-nm colloidal gold (PAG15 nm) was from CMC (Utrecht, The Netherlands).

Two independently derived mutant pSpe23-ΔCys208-236 cosmids were sequenced to verify the mutation (Elim Biopharmaceuticals, Inc., Hayward, CA) and used to produce recombinant VZV. Cosmid transfection, DNA isolation, and infectious-focus assay.Cosmid DNA preparation and transfection were done as previously described (34, 54). DNA was isolated from transfected melanoma cells using DNAzol (Gibco BRL, Grand Island, NY), and PCR and sequencing were performed to confirm the expected mutations. Sequencing was performed by Elim Biopharmaceuticals, Inc., Hayward, CA. Infectious focus assays were performed with melanoma cells and human embryonic lung fibroblasts (HELF) as previously described (3). Cells were fixed in 4% paraformaldehyde and stained with polyclonal anti-VZV human immune serum (44) and secondary anti-human biotin (Vector Laboratories, Inc., Burlingame, CA). The cells were stained with the Fast Red substrate (Sigma).

After 24 h, cells were inoculated with rOka-infected cell inoculum or cell-free HSV-1 (2.0 × 105 PFU) or with UV-inactivated rOka or were mock infected. Statistical differences in the titers of the mutant and the control viruses at each time point were determined by Student’s t test. Construction of expression plasmids and transfection.The wt gE and the ΔCys208-236 mutant gE sequences were cloned in the expression plasmid pCDNA3.1+ (Invitrogen, Carlsbad, CA). Wt gE and mutant ΔCys208-236 sequences were amplified using the gEp-fw primer containing the Kozak sequence after the HindIII site (5′-CGCAAGCTTGCCACCATGGGGACAGTTAATAAACCTG-3′) and the gEp-rev primer (5′-CGCCTCGAGTCACCGGGTCTTATCTATATAC-3′) containing an XhoI site (the restriction enzyme sites are underlined in the sequences above). For immunohistochemistry, slides were developed by using alkaline phosphatase-based enzyme detection methods with 5-bromo-4-chloro-3-indolyl p-toluidine salt/nitroblue tetrazolium chloride substrate (Vector Laboratories) or Fast red substrate. The pCR4-TOPO plasmids containing the different PCR fragments were digested with HindIII and XhoI, and the fragments were inserted into pCDNA3.1+ in the HindIII and XhoI sites. To analyze gE dimer formation, the hemagglutinin (HA) tag (YPYDVPDYA peptide) or the FLAG tag (DYKDDDDK peptide) was inserted by PCR at the C terminus of the wt gE and mutant gE before the stop codon using the EcoRI-fw primer (5′-CTCTCTCATATGAATTCCGGTTG-3′; the EcoRI site, nt 1227 to 1232 of ORF68 in P-OKA, is underlined) and the HA-rev primer (5′-CGCCTCGAGTCAAGCGTAGTCTGGGACGTCGTATGGGTACCGGGT CTTATCTATATAC-3′; the XhoI site is underlined, and the HA sequence is indicated in boldface) or the FLAG-rev primer (5′-CGCCTCGAGTCACTTATCGTCGTCATCCTTGTAATCCCGGGTCTTATCTATATAC-3′; the XhoI site is underlined, and the FLAG sequence is indicated in boldface).

American Society for MicrobiologyJournal of Virology
The PCR fragments were cut with EcoRI and XhoI and cloned into pCDNA3.1+gE or pCDNA3.1+ΔCys208-236, replacing the EcoRI-XhoI wt fragment. T cell markers were detected with the mouse monoclonal anti-CD3-phycoerythrin (Becton Dickinson). Forty-eight hours posttransfection, the cells were harvested in radioimmunoprecipitation (RIPA) buffer and analyzed by immunoprecipitation. Immunoprecipitation and Western blotting.Melanoma cells were infected with the recombinant rOka-ΔCys mutant, along with the rOka control, and protein lysates were collected in RIPA buffer for analyzing the gE/gI interaction or in 25 mM Tris-HCl, pH 7.4, 5 mM EDTA, 15 mM NaCl, and 0.1% NP-40 for studying the gE/IDE interaction (30); lysis buffer was supplemented with protease inhibitor cocktail (Complete minitablet; Roche Inc., Indianapolis, IN). Protein lysates from uninfected melanoma cells were used as a negative control. Figure 1A shows the results of a titration experiment using the gpIVCAT reporter plasmid and A3.01 (T) cells. By competing with the cell death pathways it maintains the longevity of the cell and, therefore, the longevity of varicella in the cell.

(B) Expression of Nestin and β-Tubulin-III in human TGs at indicated magnification. These peptides were used to immunize rabbits, and antisera were obtained (Sigma-Aldrich). Images were assembled with Adobe Photoshop and Illustrator (Adobe Systems Inc., San Jose, CA.). Mouse IgG (Vector Laboratories, Inc., Burlingame, CA) or the beads used for preclearing the lysates were used as a negative control. The aa-57-to-60 block mutant consistently showed the highest residual activity. The cultures contained enteric neurons and glial cells but were nearly free of fibroblasts or smooth muscle cells. A polypeptide with a size of 16 kDa was detected (Fig.

All antibodies were diluted in FACS buffer, antibody incubations were performed in the dark on ice for 30 min, and between each antibody step cells were washed in 2 ml of FACS buffer. DNA sequence analysis was obtained by an automated dideoxy-chain termination (35) using 1 pmol of the appropriate 63F3, 11F3, or 68F3 primer. (C) Location of ORF67, which encodes gI, in the pvSpe21 cosmid. Control stocks were prepared by infecting ARPE30 cells with 2 × 104 PFU of either 30-IXAla or 30-ZF3A. Samples were analyzed by Western blotting using the anti-gE MAb 3B3, rabbit polyclonal anti-IE63 antibody (a kind gift from W. The verification of the presence of the changes in VZV was carried out through Southern blotting of AgeI-digested infected cell genomic DNA, purified from VZV-infected MeWo cells using Qiagen’s blood and cell culture DNA midi kit (Valencia, CA), onto a positively charged nylon membrane (Nytran SuPerCharge; Schleicher & Schuell, Keene, NH). , in contrast to cellular DNA amplified from human ganglia removed at autopsy for Fig.

Transient expression of immediate-early viral proteins and inhibition of late viral gene expression in infected fibroblasts with phosphonoacetic acid had no effect on MHC-I. gE expression was most prominent at the cell boundaries of both neurons and satellite cells. gE was detected with the anti-gE MAb purchased from Chemicon and the rabbit polyclonal anti-gI antibody (a gift of S. Silverstein, Columbia University, New York). Confocal analysis was performed at the Cell Sciences Imaging Facility (Stanford, CA) with a Zeiss LSM 510 confocal laser scanning microscope (Carl Zeiss, Inc.). Analysis of glycoprotein maturation.Analysis of gE and gI glycosylation in infected melanoma cells was performed with endoglycosidase H (EndoH), PNGase F, and neuraminidase. Twenty to 40 μg of total protein lysates from rOka- or rOka-ΔCys-infected melanoma cells was digested with EndoH or PNGase F (New England BioLabs) for 1 h at 37°C, according to the manufacturer’s instructions.

For the neuraminidase (Sigma) and PNGase F cotreatment, protein lysates were first incubated with neuraminidase for 1 h at 37°C and then with PNGase F for an additional 1 h. Lysates from uninfected cells were used as negative controls in all experiments. By 48 h after inoculation, >90% of cells expressed VZV or HSV proteins (data not shown). Infection of human skin xenografts in SCIDhu mice.Skin xenografts were made in homozygous CB-17scid/scid mice, using human fetal tissue supplied by Advanced Bioscience Resources (Alameda, CA) according to federal and state regulations (44, 45). Animal use was in accordance with the Animal Welfare Act and was approved by the Stanford University Administrative Panel on Laboratory Animal Care. rOka and rOka-ΔCys mutant viruses were passed three times in primary HELF before inoculation of the xenografts. (A) Photograph of a DRG xenograft 12 weeks after transplantation (cephalad direction to the left) under the renal capsule.

Skin xenografts were harvested at 10 and 21 or 22 days postinoculation and analyzed by infectious focus assay and immunohistochemistry with polyclonal anti-VZV human immune serum (44). Virus recovered from the tissues was tested by PCR and sequencing to confirm the expected mutations. Primary human tonsil cell preparation and fluorescence-activated cell sorting analysis.Primary tonsil T cells were prepared from human tonsils obtained from the Department of Pathology, Stanford University Medical Center, according to a protocol approved by the Stanford University Committee on Human Subjects in Research. The cells were treated with antibodies and fluorescent conjugates to CD3 and VZV proteins, and the percentages of VZV-positive T cells were measured. Primary HELF infected with rOka or the rOka-ΔCys mutant were overlaid with 1 × 107 tonsil cells; uninfected fibroblasts overlaid with tonsil cells were used as a negative control. The tonsil cells were processed for fluorescence-activated cell sorting staining 48 h postinfection as previously described (4), and the titers of the infected fibroblasts were determined on melanoma cells. Samples were analyzed on a FACSCalibur apparatus (Becton Dickinson, Inc.).

We have shown that the ORF 29 protein modulates the activity of the IE62 major transactivator in a cell type- and promoter-specific manner. It can remain there for many years without interfering with function. Upon v63G/70R infection, glucose utilization rapidly declined in MeWo cells, most likely a consequence of lytic VZV replication as seen microscopically by extensive VZV-induced cytopathic effects (data not shown). 1Aa), while no 37-kDa gM was detected in virions. PCR was performed on p29A35P with either A35Ptop (5′-GGGTTTTTGGCCGCTCGTAGCACG-3′) and 29EcoRV3′ or 29EcoRV5′ and A35Pbot (5′-GGGCGTGCTACGAGCGGCCAAAAA-3′) primers. For the cell-free virus entry experiments, the cell-free preparation obtained from infected HELF was used to infect melanoma cells. 6470).

VZV IE63 interacts preferentially with human ASF1a.Since the human genome carries two ASF1 genes, we determined if VZV IE63 shows preferential binding to ASF1a or ASF1b. Incubation of the 16-kDa protein immunoprecipitated from VZV ROka47S-infected cells with alkaline phosphatase yielded a 15-kDa band. After LPS treatment the resulting cells displayed the characteristic stellate morphology of mature DCs (Fig. 3C, D, and E, respectively), primer set C detected ORF 43 transcripts (Fig. pCDNA-gI, pBudCE4.1, and pBudE-gE were digested with HindII and XbaI and gel purified, and ORF67 (gI) was ligated into the CMV promoter site of pBudCE4.1 to generate the construct pBudC-gI with ORF67 (gI) under the CMV promoter or into pBudE-gE to generate the construct pBud-gE/gI with ORF67 (gI) under the CMV promoter and ORF68 (gE) under the EF-1α promoter. Relatedness of pORF30 and the human TopI core subdomains.When the 770-amino-acid pORF30 sequence was submitted to the PHYRE2 protein fold recognition server, pORF30 residues 589 to 647 were modeled with >90.3% confidence to portions of human topoisomerase I (TopI) subdomains I and II (Fig. Specimens were sectioned with an Ultra microtome (Leica), and the sections were collected on copper grids.

Approximately 1 × 105 cells were then stained with APC-Annexin V and 7-amino-actinomycin D (7-AAD). Silverstein, Columbia University, New York) at a dilution of 1:5. Our recent experiments with VZV mutants that express kinase-defective forms of ORF47 protein have suggested that VZV cell-to-cell spread does not depend on the efficient assembly of complete, enveloped virions in vitro or in skin xenografts in vivo (7). ). The use of the bridging antibody also amplified the signal. Samples were stained with 3.5% aqueous uranyl acetate for 10 min and with 0.2% lead citrate for 3 min and examined on a Joel 1230 transmission electron microscope. Deletion of the first cysteine-rich region of the gE ectodomain and effect on VZV replication in vitro.To identify potential functions associated with the first cysteine-rich region of the gE ectodomain, we first tested the effect of deletion of this region on VZV replication.

In the gE-ΔCys mutant, the region from cysteine 208 to cysteine 236 was deleted and replaced by a dodecameric linker coding for the 4-aa peptide Leu-Arg-Pro-Gln (3) (Fig. 1A). The pSpe23-ΔCys208-236 cosmid containing the gE mutation was transfected with the intact pFsp73, pPme2, and pSpe14 cosmids in melanoma cells; pSpe23 containing the wt sequence of gE was transfected along with the other cosmids as a control. Recombinant virus, named rOka-ΔCys, was recovered from the transfection of two independently derived clones of pSpe23-ΔCys208-236, indicating that the first cysteine-rich region of the gE ectodomain was not essential for viral replication in vitro. In contrast to these effects of infectious VZV, exposure to UV-inactivated VZV-infected cells induced nuclear localization of the NF-κB proteins in fibroblasts that persisted throughout the 48-h period (Fig. 1B) because the cells were depleted in the control due to more rapid replication. In addition, the ΔCys mutation was associated with a reduction of the plaque size (rOka, 1.17 ± 0.23 mm; ΔCys, 0.81 ± 0.22 mm; P < 0.0001), suggesting impairment of the ability of the mutant virus to spread from cell to cell (Fig. 1C and D). Analysis of VZV-Infected DRG by TEM. 1E); this decrease in rOka-ΔCys mutant replication was associated with a small-plaque phenotype (Fig. 1F and G), as observed in the melanoma cells (Fig. 1C and D).

You may also like

American Society for MicrobiologyJournal of Virology

American Society for MicrobiologyJournal of Virology

Herpes simplex encephalitis (HSE) remains the most common cause of sporadic fatal encephalitis in the world. Herpes gladiatorum, one of the most infectious forms of the disease, is spread through skin contact and saliva. Histopathological analysis of ventricular tissues showed large interstitial and scarring fibrotic areas with a moderate mononuclear cell infiltrate compatible with histological aspect of chronic myocarditis. Famciclovir is also used to treat returning herpes simplex infections of the skin and mucus membranes (mouth, anus) in people with human immunodeficiency virus (HIV) infection. In rare instances, a publisher has elected to have a “zero” moving wall, so their current issues are available in JSTOR shortly after publication. It was reported that cancer was not found in 2% of patients with anti-Yo antibodies1; a subgroup of these cases might be virus-induced. Strikingly, in vivo neutralization of TNF in HSV-1-infected p55−/− p75−/− mice by use of three independent approaches (treatment with soluble p55 receptor, anti-TNF monoclonal antibody, or in vivo small interfering RNA against TNF) resulted in significantly increased mortality rates (P = 0.005), comparable in magnitude to those for C57BL/6 mice treated with sTNFR1 (P = 0.0018).
American Society for MicrobiologyJournal of Virology

Overall, these results indicate that while TNF is required for resistance to fatal HSE, both p55 and p75 receptors are dispensable. One of the horses was so ill it had to be euthanized, officials said. ↵*Corresponding author. Mailing address: City of Hope Medical Center and Beckman Research Institute, Department of Virology, 1500 E. In adults, this necrotizing encephalitis involves the medial temporal and inferior frontal lobes; recent reports indicate that levels of cytokines and other markers of immune activation in CSF are elevated (6, 7). Phone: (626) 301-8480. Fax: (626) 301-8852.

I did not go see a doctor because everything that I read said that you need to go in the first few days of an outbreak or the results could come back false negative so what was the point.

You may also like