Point Mutation Causing Constitutive Signaling of CXCR2 Leads to Transforming Activity Similar to Kaposi’s Sarcoma Herpesvirus-G Protein-Coupled Receptor

Point Mutation Causing Constitutive Signaling of CXCR2 Leads to Transforming Activity Similar to Kaposi’s Sarcoma Herpesvirus-G Protein-Coupled Receptor

There’s been research done which show that 50% of the folks in America actually have the herpes virus. including, illness, poor diet, psychological or physical anxiety, friction within the vaginal area, prolonged experience of ultraviolet light (commonly for dental herpes, such as a beach trip or skiing weekend), medical injury, or steroidal medicine (such as for example asthma treatment) may trigger a herpes outbreak. Research have displayed that individuals who are attacked with herpes simplex virus type 2 are usually roughly three times more likely to turn into contaminated with HIV, and folks with both HIV and herpes happen to be more very likely to propagate HIV to others. Latest herpes research data shows that more than 110 million people in the U.S. One can avoid the spread of this herpes and assist in healing by keeping the damaged region dry and clean. Type 2 herpes can cause the lining of the anus to become inflamed, a problem called proctitis, records This is particularly true for those who take part in anal sexual activity. In some instances a individual gets infected with herpes virus, provides first break out, and will not possess any other herpes signs and symptoms afterwards.

Buyers can select from either six-speed manual or automatic transmissions. It’s common for females with genital herpes to be concerned about what their an infection might mean because of their newborn. Keratitis Medicamentosa is a condition developed due to the topical application of medications. A second injection flushes the polymer out when a man wants to reverse the procedure, Allen explains. despite everything you are thinking right now, the herpes virus is not at all something you had been cursed with and you’ll must take to your grave. The average annual cost of therapy for herpes simplex therapeutics ranges between $725 and $2,050 based on the treatment regimen (reduction or suppression therapy). Australian pricing, model range, and specifications will be revealed closer to the Impreza’s local launch towards the end of 2016.

The CXCR2 activates the same signal transduction cascade, when it binds its ligands that include IL-8, GRO-α, and NAP-2, but does not exhibit constitutive signaling. The KSHV-GPCR appears to be involved in the pathogenesis of Kaposi’s sarcoma (4) and primary effusion lymphomas (5). The Spanish nurse who contracted Ebola virus while caring for a dying priest appears to be the victim of the first transmission in this outeak to have taken place Acne; Herbal Tips; Spark your eye + any discomfort of eyes and helps to remove dark circles within few this simple mask twice a week for dark I’ve been using an aasive scrub twice a day to get my skin squeaky clean. The company’s first clinical trial, for a rare genetic form of blindness called Leber congenital amaurosis (LCA) 10, will not even begin until 2017, CEO Katrine Bosley announced in November. The DRY sequence at the junction of the third transmembrane domain to the second intracellular loop of the CXCR2 is a highly conserved motif among G protein-coupled receptors. Pregnant women should let their doctor know if they experienced herpes or been subjected to herpes. 4.

In addition, mutations inducing constitutive activation of GPCRs have been described and found to be associated with human diseases (12, 13). In this study, we report that the replacement of Asp138 by Val in the second intracellular loop of the CXCR2 constitutively activates the receptor and causes transformation in transfected NIH 3T3 cells comparable with results seen with the KSHV-GPCR. Furthermore, we show for the first time that the CXCR2 wild type itself is able to transform transfected NIH 3T3 cells due to autocrine stimulation by mouse KC, the mouse equivalent of GRO-α, which binds to the CXCR2 and is produced by mouse fibroblast NIH 3T3 cells. These data provide support for a role of the CXCR2 in cell proliferation and tumorigenesis. DNA constructs. The CXCR1 and CXCR2 receptor constructs have been described (14). The KSHV-GPCR was amplified by RT-PCR from BCBL-1 lymphoma cell RNA (obtained from Dr.

Jaques Corbeil, University of California, San Diego) using the 5′ oligo GAGAATTCAGGCCATGGCGGCCGAGG and the 3′ oligo GAGAATTCACGTGGTGGCGCCGGACA and cloned into the EcoRI site of pSFFV.neo (15). D138V and D138Q are point mutations of the CXCR2 in which Asp138 (GTA) is replaced by Val (GCA) or Gln (GAA). Point mutations were introduced by two rounds of PCR amplification. The correctness of the constructs was verified by automated DNA sequencing. The sequences are shown in a schematic form in Fig. According to Dr Buehlern, _Herpes Cure_ treatment separates protein ICP-47 from the nerve cells and lets body_s defense mechanisms eradicate herpes virus from human body. NIH 3T3 mouse fibroblasts were grown in DMEM containing 10% FCS and transfected with CXCR1, CXCR2, KSHV-GPCR, or mutant receptor constructs by the calcium phosphate precipitation technique (16), followed by a 3-min glycerol shock after 5 h.

Stable cell lines were selected with 600 μg/ml of G418. It is recommended to consider a herpes virus blood test upon conclusion of herpes treatment. Stable cell lines were selected with 300 μg/ml G418. Receptor expression was verified by FACS analysis using polyclonal rabbit Abs raised against a fusion protein of the first 44 amino acids of the receptors with GST, as described (17). Binding of 125I-labeled IL-8 was determined as previously described (14). NIH 3T3 cells were transfected with the receptor constructs (1 μg plasmid DNA per 60-mm dish) in quadruplicates, and cell foci were counted after 18–21 days. In addition, 200 stably transfected cells were seeded on a layer of 2 × 105 untransfected NIH 3T3 cells, as described (18), and cell foci were counted after 2 wk.

A total of 4 × 104 stably transfected NIH 3T3 cells was mixed in an equal amount of DMEM containing 10% FCS and 0.3% melted soft agar in medium and poured onto a bottom layer of 0.6% soft agar. Cells were fed every 3 days with three drops of media, and cell colonies formed were photographed after 2–3 wk. Subconfluent NIH 3T3 cells were labeled for 48 h in 12-well plates in inositol-free DMEM (Life Technologies, Grand Island, NY) containing 1 μCi/ml [3H]myoinositol (Amersham, Arlington Heights, IL). Cells were washed in DMEM containing 10 mM LiCl and 1 mM CaCl2 and incubated for 10 min at room temperature, followed by 20 min at 37°C. Inositol phosphates were extracted with 10% perchloric acid, followed by neutralization with KOH/Tris. [3H]inositol phosphates were separated by anion-exchange chromatography on AG 1-X8 formate resin (Bio-Rad, Vista, CA), as described by Berridge (19). Inositol phosphate accumulation was expressed as the percentage of 3H label in inositol phosphates per μg of protein in the cell precipitates.

RBL2H3 cells stably transfected with the different receptor constructs were labeled with Indo-1AM (Molecular Probes, Eugene, OR), and Ca2+ flux was measured on an SLM 8000 fluorometer (Spectronic Instruments, Rochester, NY), as previously described (14). The consequences of expression of CXCR2, CXCR1, mutant receptors, and KSHV-GPCR on cell growth were investigated in NIH 3T3 cells. Focus formation in these cells represents a morphologic manifestation of transformation associated with the loss of contact inhibition that limits the cell density of these cells. The focus formation assay was performed in two different ways by plating 200 stably transfected NIH 3T3 cells on a layer of untransfected cells or by transient transfection (Figs. 2⇓ and 3). Focus formation assay. Two hundred NIH 3T3 cells, stably transfected with the different receptors or mutants as indicated in the figure, were seeded on a layer of 2 × 105 untransfected NIH 3T3.

Foci were counted and photographed after 2 wk. Untransfected cells (NIH 3T3) and cells transfected with the vector only (pSFFV.neo) served as negative controls. Surprisingly, cells transfected with the wild-type CXCR2 also formed foci, although to a lesser extent, which were observed with both methods and not seen with untransfected NIH 3T3 fibroblasts, those transfected with the pSFFV.neo vector only, or with the CXCR1 (Figs. 2⇑ and 3⇓). Cells within foci caused by the CXCR2 manifested the malignant phenotype with a loss of density-dependent growth inhibition, resulting in increased cellular packing and piling up of cells. This oncogene-like ability of the CXCR2 to induce transformation is presumably due to continuous autocrine stimulation of the receptor by mouse KC, the mouse equivalent of GRO-α, produced by NIH 3T3 cells. Overnight cultures of NIH 3T3 cells contained between 12–20 ng/ml of mouse KC, which is a sufficient concentration to activate the human CXCR2 (21).

Total numbers of focus formation assessed by two different methods: A, 200 cells derived from a clone of G418-selected NIH 3T3 cells expressing the different receptor constructs were plated together with 2 × 105 untransfected NIH 3T3 cells, or B, NIH 3T3 cells were directly transfected with 1 μg of each plasmid DNA. The number of foci formed by cells transfected with CXCR2, KSHV-GPCR, and the D138V mutant are significantly higher than untransfected cells or those transfected with CXCR1 or the D138Q mutant. The mutant receptor D138V, in which the Asp of the DRY sequence in the second intracellular loop of the CXCR2 was exchanged for the corresponding hydrophobic Val in the KSHV-GPCR, caused almost as many foci as the KSHV-GPCR. In contrast, the CXCR2 mutant D138Q, in which the same Asp was replaced by the hydrophilic Gln, induced a complete loss of the transforming potential of the CXCR2. These results emphasize the importance of the highly conserved DRY sequence for G protein coupling in CXCR2. In contrast, the same point mutation, corresponding to the D138V in CXCR2, that exchanges the Asp for a Val in the CXCR1 (D134V-CXCR1) or continuous stimulation of the CXCR1 with IL-8, did not result in focus formation (Fig. 2⇑).

FACS analysis indicated that surface expression of the CXCR1, CXCR2, and the D138V and D138Q mutants was similar, even a little higher for the D138Q mutant (data not shown), so that differences in the level of expression could not explain the varying behavior of these receptors. The transforming potential of the CXCR2, mutant receptors, and the KSHV-GPCR was paralleled by their ability to form colonies in soft agar. Cells transfected with the CXCR2, the D138V mutant, or the KSHV-GPCR all formed colonies after 2–3 wk in culture (Fig. 4⇓). Colonies of CXCR2-transfected cells tended to stay smaller than those of cells transfected with the KSHV-GPCR or the D138V mutant, but clearly grew in an anchorage-independent fashion, usually associated with the potential to metastasize (22). Untransfected cells or those transfected with the D138Q mutant or the CXCR1 failed to grow in soft agar (Fig. 4⇓).

Point Mutation Causing Constitutive Signaling of CXCR2 Leads to Transforming Activity Similar to Kaposi’s Sarcoma Herpesvirus-G Protein-Coupled Receptor
Cell proliferation in soft agar. Transfected NIH 3T3 cells were seeded and grown in 0.3% agar containing medium on a bottom layer of 0.6% agar. After 2–3 wk, cell colonies were photographed. A, Untransfected NIH 3T3 cells; B, CXCR2; C, KSHV-GPCR; D, CXCR1; E, D138V; F, D138Q. Activation of phospholipase C is a major pathway that links G protein-coupled receptor activation to cell proliferation (3, 23). To evaluate G protein-coupled signaling through this pathway, we measured inositol phosphate accumulation in NIH 3T3 cells stably transfected with the various receptors and the mutants. In agreement with previous reports (3), NIH 3T3 cells transfected with the KSHV-GPCR accumulated 3.5 times the amount of inositol phosphates observed in untransfected control cells.

This increase could not be blocked by pertussis toxin treatment of these cells, which only caused small, nonspecific inhibition of inositol phosphate accumulation that was seen in all cells treated with pertussis toxin (Fig. 5⇓). It also could not be blocked by Abs against the CXCR2 or against mouse KC (Fig. 5⇓). Inositol phoshate accumulation in NIH 3T3 cells and inhibition by pertussis toxin, anti-CXCR2, and anti-mouse KC Abs. Results are normalized to untransfected cells (= 100%). Data of baseline inositol phosphate accumulation of the different receptors and mutants are means of six to nine experiments.

SDs of triplicate experiments on the same day were less than 5%. The inositol phosphate accumulation in cells transfected with CXCR2, KSHV-GPCR, and the D138V mutant is significantly higher than in untransfected cells or those transfected with CXCR1 or the D138Q mutant. Addition of anti-CXCR2, anti-mouse-KC Abs, or pertussis toxin treatment led to significantly lower inositol phosphate accumulation in CXCR2-transfected cells compared with KSHV-GPCR- or D138V-transfected cells. Cells transfected with the CXCR2 showed a 2.9-fold higher accumulation of inositol phosphates than untransfected NIH 3T3 cells (Fig. 5⇑). No further increase in inositol phosphate formation was seen, when 10−7 M IL-8 was added. Stimulation of this pathway in CXCR2-transfected cells seemed to be mediated by mouse KC, since either Abs to mouse KC or to the CXCR2 inhibited inositol phosphate accumulation (Fig.

5⇑). Pertussis toxin, which inactivates Gi largely, but not completely, blocked inositolphosphate formation (Fig. 5⇑). In contrast, accumulation of inositol phosphates in cells transfected with the CXCR2 mutant D138V (3.1-fold higher than found in untransfected NIH 3T3 cells) could not be blocked by either of the Abs, and pertussis toxin blocked inositol phosphate accumulation in these cells only to a small degree (Fig. 5⇑). Together these results suggest that this mutant receptor signals in an agonist-independent fashion similar to the KSHV-GPCR. The CXCR2 mutant D138Q, in which the same Asp was replaced with Gln, showed only a small increase of inositol phosphate turnover over untransfected NIH 3T3 cells (Fig.

5⇑), which is consistent with the low potential of this mutant to form foci. A similar behavior was seen in cells transfected with the CXCR1. As shown in Figs. 6⇓ and 7, CXCR2- and CXCR1-transfected cells showed a high level of actin polymerization and calcium mobilization upon stimulation with IL-8. At high concentrations, the CXCR2 mutant D138Q responded almost as well as the CXCR2, but the mutant showed a much lower affinity. Approximately 20-fold higher concentrations of ligand were necessary for a response equal to that seen with the wild-type receptor. These functional results were confirmed by 125I-labeled IL-8 binding studies that showed a Kd of 1.2 × 10−9 M for the CXCR2 and a Kd greater than 2 × 10−8 M for the D138Q mutant.

The affinity of GPCRs not coupled to G proteins generally drops by 1–2 orders of magnitude. All of these results are consistent with poor G protein coupling of the D138Q mutant. Actin polymerization in transfected RBL2H3 cells. Cells were stained and fixed with phalloidin-Formalin at the indicated time points after stimulation with 200 nM human IL-8. Results are means of three experiments ± SEM. Actin polymerization is significantly higher in CXCR2-, CXCR1-, and D138Q-transfected cells compared with untransfected, KSHV-GPCR-, or D138V-transfected cells. In CXCR2-transfected cells, the Ca2+ mobilization was transient and Ca2+ concentrations quickly fell back to almost background levels, whereas Ca2+ remained elevated over a prolonged time in D138Q-transfected cells.

Ca2+ mobilization and actin polymerization could be completely blocked by pertussis toxin in CXCR1, CXCR2, and D138Q (data not shown). In both assays, the KSHV-GPCR and the mutant D138V showed only a small response to IL-8 stimulation, consistent with the idea that these receptors exhibit constitutive activity independent of ligand. In accordance with the report of Gershengorn et al. (2), the KSHV-GPCR as well as D138V can be activated by IL-8 over constitutive levels, which could mean that additional stimulation might even enhance the functional activities of these receptors. It has been demonstrated for several receptors that discrete mutation can cause dramatic increases in agonist-independent receptor activity (24). It was therefore proposed that important conformational constraints maintain the receptor preferentially in an inactive conformation and that these constraints are released upon activation, causing key sequences to be exposed to the G protein (25). Single point mutations seem to be able to change the receptor conformation leading to constitutive activation, thereby mimicking the active state of the wild-type receptor.

Constitutive signaling, as shown by some native GPCRs (26), occurs more commonly with mutated GPCRs (24, 27) in several human diseases and in tumors (28, 29). The KSHV-GPCR has been recently described as a naturally occurring receptor exhibiting constitutive signaling, which is thought to play a role in the pathogenesis of Kaposi’s sarcoma. It has been speculated that the KSHV pirated the gene encoding for the KSHV-GPCR from CXCR2 or CXCR1, its closest homologues, and retaining similarities to these receptors. Our study points out the importance of the DRY sequence in CXCR2 for regulated signaling function and the significance of the mutation to a VRY motif, the respective sequence in the KSHV-GPCR, which makes the CXCR2 functionally similar to the KSHV-GPCR. The DRY sequence at the junction between the third transmembrane domain and the second intracellular loop is shared by almost all GPCRs, including the chemokine receptors. The importance of this sequence for G protein coupling has been shown for the CCR5 (30). The surrounding amino acids are also highly conserved among chemokine receptors and necessary for proper signal transduction (31).

Sequence homology between the CXCRs and the KSHV-GPCR is higher in this region than in any other area outside of the transmembrane domains. The second intracellular loops of both the CXCR2 and the KSHV-GPCR contain the basic amino acids at both the NH2- and COOH-terminal ends that are necessary for interaction with Gi proteins (32, 33). Replacement of the Asp in the DRY sequence by the bulky hydrophobic Val in this location, as seen in the KSHV-GPCR and in our D138V mutant, presumably pulls this region into the plasma membrane. The more conservative D138Q mutant would not be expected to have this effect. It has been proposed that the α-helical structure of the third transmembrane domain of GPCRs continues on into the second intracellular loop. Hydrophobic residues of the second intracellular loop are thought to interact with α-helical structures of the third intracellular loop, while amino acids in the second intracellular loop that face away from the third intracellular loop are considered important to keep the receptor in an active state in the absence of ligand (34). Our results are consistent with this hypothesis.

In contrast, continuous stimulation of the CXCR1 with human IL-8 or introducing the point mutation that exchanges the Asp for a Val into the CXCR1 receptor (D134V-CXCR1) did not result in transforming capacity (Fig. 2⇑), although both the CXCR1 and the mutant receptor were expressed as assessed by FACS (data not shown). Hence, the similarity in the signaling of the CXCR2 mutant D138V and the KSHV-GPCR supports the hypothesis that the gene of the KSHV-GPCR has been pirated from the CXCR2. In addition, it emphasizes the transforming potential of the CXCR2, which seems to be exhibited only by the CXCR2 and not by the CXCR1. Being continuously stimulated or constitutively activated due to a single amino acid change in the receptor, the CXCR2 seems to activate normal cellular genes with latent transforming potential and subvert regulatory key pathways controlling cell proliferation. There have not been any reports about the transforming potential of the CXCR2 to date, although Norgauer et al. (35) showed that the CXCR2 exhibits a growth-promoting function in melanoma cells that could be blocked by Abs against the CXCR2.

It also has been shown for other G protein-coupled receptors that persistent activation can transform cells (18) and act as oncogenes in human cancers (29). These pathways are complex (23) and not understood in detail. Increased inositol phosphate turnover seems to play a role, and indeed occurred in all focus-forming mutants we analyzed. Leukocytes and leukocytic cell lines such as RBL2H3 cells express such a high level of Giα2 that the signal transduction cascade in these cells following stimulation with IL-8 is dominated by the activation of Giα (36). The CXCR2 can, however, also couple to Gα14 and Gα16 (37), and possibly additional G proteins. Pertussis toxin largely, but not completely, blocked inositol phosphate accumulation in NIH 3T3 cells expressing the CXCR2, while it abrogated functions induced by IL-8 in RBL2H3 cells expressing the same receptor. Indeed, actin polymerization, which was blocked completely by incubation with pertussis toxin in RBL2H3 cells, was not affected by this Gi and Go protein-specific inhibitor in NIH 3T3 cells (Schraufstatter et al., unpublished observation).

Another G protein, possibly Gα12 or Gα13, must mediate this response in NIH 3T3 cells. Gα12 has recently been described to be involved in cellular transformation caused by m1 muscarinic acethylcholine receptors in NIH 3T3 cells (38). The relative contribution of various G proteins in CXCR2-transfected NIH 3T3 cells warrants further evaluation. Expression of the CXCR2 has been shown to be present on many different cell types, including leukocytes and related cell lines, melanoma cells, and breast cancer cells (39). IL-8 and Gro-α are produced by various cell types and are known to be angiogenic and mitogenic for endothelial cells (40). But the IL-8 mitogenic signaling pathway has not been defined, and cellular chemokine receptors have not been tested carefully for mitogenic activity. In addition, it has been proposed repeatedly that IL-8 acts as an autocrine promoter of cell proliferation (41) and even human tumor growth, e.g., in non-small cell lung cancer (42) or gastric carcinoma (43).

These reports together with our findings suggest that IL-8 produced by tumor cells may regulate cell proliferation and tumor growth in an autocrine fashion via CXCR2. The KSHV-GPCR in Kaposi’s sarcoma might thus be used to connect constitutively to the pathway that is used for IL-8-induced angiogenesis, one of the main features in Kaposi’s sarcoma histology besides inflammation and proliferation. In conclusion, we propose that IL-8 and other ligands of CXCR2 may act as autocrine growth factors in tumors or at sites of inflammation through the activation of CXCR2, and that the KSHV-GPCR may use the same signal transduction cascade as the CXCR2.

You may also like